Description :
From Genome Similarity Track
Location :
scaffold_13:14963- 16081
Transcript NameFunction/comments
g795.t1 hypothetical protein PHYSODRAFT_245864

Sequence
1118 bases(100 bases per row)
TAGCGACCACAACGTCCGCCATGTTATCCACCCAGCCCCACGCGATGACCGAGATACGACCTTCTTCCCGCACTGGAACGTCCTGCAGGATGCCGTGGCG
CCAGATCACGTTTGTGTCCTTGGAGAAGGCGTAGACGCATCCGTCCGGCTGCGGCACACTCACCACCGTCTTGGTCTCAGCATGTTCGAAGGCGGCGTCG
CGGGTAGCGCCGAACGAAATGGCGACCGTGAAGTTCTGGATGGCCGCAATGTGAGGCTTGACAGCCGCTGCGTCAAAATGGAACGGCTTCCACTGCGAAG
TGTCCTTGTACCAGTTGAAGCGCGTGGCCTTAATGTCCAAGCTGAAAAACTCCTTCAATCGGTCCGTGACGAGGTCGAACGTGGGGCACTTGGCCTTCCA
ACTCGAATGGTCGTCCACAATGAGGTGCGTGCCGTCGATCTTGTTGTTGCCGTGCCACATTTTGAGAAGCTGCTCGCGCGGAATGCCGCAGTTGTCGAGC
TCGTGCATGAGCTTCGTGTAAAGCTCTCCCTTTTTAAAATCGCTGAAGAGATTGGGCACGAGCACCACATCACGAGAGGTCAGCGGGGTGGAGAATTTGT
CGTCCTTGGAGCCCAAATCGTACGTGAGGCGCAGATCCACGGGCTTGGTCATGGGCTCAAAGCTCTCCGTGTTCTTCTTGGTGGCCTGGCGTCGCTCGTT
CTTCTTTTTCTTCTTTATCTTCTTGTCACTGTCCTGCTTGTCCGCATCCTTGGGGGTCGTCTCCTCCGTGTCCTTAGACTTCACCTCCTTCTCCTTGGGC
CTTTTGTCCTTCGGCTTCCGGACCTTCGGCTTCTTTTTCTTGTCTGGCTCCTCTTCATCCTTGGCAGCAACTTCCTCCCCCTTGGCATCCGGATCGGGCA
GCGTGACGACGTGTTTCTTGTTGCACTCGGCGCCAAACTTGCACTGACCCGTCCGCCAGAAGTACGCGCACAGCTGCTTGTCGTGCACGAACTTGCAGCC
AGCGCGCGTGCACTTTCTGTTACGCATAAAGGTGCGGCATACGCTCTTGAAGAGTCCGGCCTCGTCCTCGAAGTGCAGCGGCTTCTTCTCTTGCGGTGGC
GCGTCGTCCGCCATGTTC