Description :
From Genome Similarity Track
Location :
Scaffold_688:14960- 18062
Transcript NameFunction/comments
Phyta_totarag10172unknown
Phyta_totarag10173hypothetical protein PHYSODRAFT_472228

Sequence
3102 bases(100 bases per row)
GCGTCTGCTCCACAGCTCGCGCCCCGCTTTGGCGCAGTCTTTCGACGACAGTGGCATGCCTCGCCTGCAGGACACTCCGGCCAACATCGTACGTTCATTT
CCAATTGTCACATTCGTGATTAGTATAATAATTGCTAATGTCATATTGTGTTTTATTGTTGTATTGCAGGGCGTGCTGATCgtgccgcagcagcgcgcgt
gGGTCGTAGAGCGCTTCGGCAAGTTCCACGAAGTGTTGACCCCGGGGCTGCACTTCTTGATCCCGCTGGTGGACCGCATCGCCTACGTACACTCGCTCAA
GGAGGAAGCCATCAAGATCCCCGGGCAGACGGCCATTACTCGGGACAACGTGACCATCAACATCGATGGTGTGCTGTACGTGAAGATCATCGACCCGTAC
AACGCCAGCTACGGGGTCGAAGATCCGCTCTACGCCGTCACGCAGCTGGCACAGACCACCATGCGCTCCGAGCTGGGCAAGAtcacgctggacaagacgt
TCGAGGAGCGCGAGTCGCTCAACTTGAGTATTGTGGAGGCGATCAATCAGGCGTCCGAGGCCTGGGGTATCAAGTGTCTGAGATACGAGATCCGTGATAT
TGCCCCGCCCCGCAGTGTCAAGGCGGCTATGGACATGCAGGCTGAGGCGGAGCGTCGGAAACGTGCCGAGATCCTGGACTCGGAGGGTGAACGTCAGGCA
TACATTAATGTGGCTGAGGGTAAGAAGCGTGCGGCTGTGTTGGAGGCAGAAGGTGGGGCCGCCGCCATTTTGGCCAAGGCGAACGCGTCGGCCGAGGCTA
TCCAGCGGCTTTCGAGCGCTATTCAGGAGACAGGTGGTCGCGACGCTGTGGCACTCCAGGTGGCGGAGAAGTACGTGGACGCCTTTGGCAACATCGCCAA
GGAGGGCACGACAGTACTACTGCCATCCAACGTGAACGACCCTTCTAGCATGGTAGCGTCGGCGCTCTCCATTTTCGGAAACATCCAGAAGCAGAACAAC
AAGGAGGCGGCTCGTATTGCTGGCAAGGCGAGCAGCCAGGATAGTGCTGAGGGAGAGCTTGGCGAGTACACTTTGGACAGCTTTGACCCAGACACGACCA
AGAACTAACCCGACATTTACAGTAGATGAGGGTCCGTCCTGACCTGCCACGAGGCAGAGGCAGTGTATGACAGGGGAGATGGTGGCTATTGCCCGACAGG
CTGGTTGGTCGTGTAGCTGACGCCACGAGGTGATAGAAATACATCAGGTAGCCCCGAGCTGAGTTGATCCGTTGACACCATGATGAAAATAAAGCAAACT
CACGGAAACTGAACGCTTTGCGTGACCATCCTGTTGGCATCTCTGAGTGGATACCTCATGAAATACGCACCCGAATTATTCATCAGACCTCCAGATAGGC
TATTTTGCGGCGTCTTGGCGGACTATTTCCGTCTCGCATGGTCAATGTGATGCTCTTTTGAGTATCGTGTGCTTACTTCATCCAACTATTATACAGTGGA
TAaactccttcagcttcgtccaACCGTGAGCAAGACCGCATCCAATGCCTTCGCTAGTCCCCGAATCGAGTGTACTTCGTGACACTTCCTCGACTGCACT
CGTTTTCCCACCATGCGCTTCATTCGAAAAGCCCTACGATTTAGACATTGTTAGGAAAATCGTCGAGCGCGAGGGCTGCCTTGAGGCtttgcagcaactc
ctcgGGGCGATGAAAAAGCCACAACAACCTCAGATCTCCGGGATATCCAAAGCACCGATGGTTTTCCAGAGCAtcatcgagcagctgcgTTCCGTGAGTG
TGCAGATTGTCGAGGACATcgagcagtggcagcaacaacaacaagttAAGGCACAGGCTACGAATTTCAAATGGCGCGGTGTGAACTACTTGCTCAAGAT
GACGGCTGATTTGGATTTCCTAGCATCCTTCAGAGGCTTCACTCTCCTCGAGTCTCTACAGGTGCTACGATTGACGCAGAACCCGTTCCTTGCTCTGATG
CACCTAGATCACCCGGCACTTCGCGAACCAGACCCTGACTACGCGTTTCAGTTGTTTGGCAACTGGGTTGGTGATGTCAGTATTCGGCGCGTATTTCCTg
cgtcgaagttgctgctgcgtgaacgGGAGGCAGActctcgacgtcgacaaATTCAACTTGGGCAATCGTCTGAAAATTCTGATCCGGTGGTAGACGCTAT
TGAATCGACATGCGACTCTGACAGCGactctgttgctgccgtaGCCTCGCTTAAAGCAAAAGAACAAGAGCAGCCAAACACTTCATCAACACGAGTGAAT
GTTCAATCTGCCAACCGAGGCGAAAGCTGCGCTTTACTCGGCACCGTAGTAGCATCAACTAACCCCCGAGAAGCAGCCATGCGCGAGGATATTGCACTGA
GCCGGGAGCTAATTACTCGGGCAGAGCACGAGTTAGGTGCTATGCGAGACGACCTTGCTGCTTTACAAGCACGTCTCAAAGACGCAGTTCTTCCAGACAA
ACGCCGTCGGTTGCAGACTCGGATCGGCAGCCTCGTCAACGATCTCAAGTTTCGTTCGGGGGACTTGTACCAGCGCAGGAACGAGCTCAAACGCAAGGAG
GCCATCTATCGTGCGACCAAAGACCGTCGCGGATCGGTCGGTGGCCCCCGAAGTCTAGCGCAGTCTCACTCGCAGCCAGCGGTTGTTACAGAGCTGTCGG
ACCGTGAACGCAAAGAGGGGGTGTACTCTTCACTGTTCGAGTCAACGCTGTTGGAGGACGAGCAGGTCCGCAACGATCTCGTTCTGCGTGTGAATGCGTC
GTTGTCTAAAGCGAGAGTGGACGAGCACAAGCGCGTCATGGGACTGGCAACACCATGTAGGCGACGGCAGAAAGCGTCTGATGAGCTGCAGAACCAACAG
CTTAAACTTCGAGGTGAAGATATGGAGCAGTGGGGAGTTCGCGAGGTGCAGAACTTCTTGGACTCGCTGGGACTTGACAACGGCAGCTACGGCGCCAACT
TTCGCGCTCAAGGTATTGACGGTGCGTTATTAGTCCAGGCAACTGACCGCGACCTCGAAGAGCTAGGCGTAAGTATTCGACTTCACCGCGTTCGCATCTT
AG