Description :
From Genome Similarity Track
Location :
scaffold_83:1496- 3186
Transcript NameFunction/comments
Pl_110172hypothetical protein PITG_02675

Sequence
1690 bases(100 bases per row)
GACGCTAACATCTTCATTTCGACGATCTCAGATATGTGTGAGCTTCTTCGTCTACCTCTAGAGAAGAAATTGTCGTAGCAGACGGACCCACGGAGAATCG
AAATGCTATCATTGGATGACGATGCAAGTCGAGAAATTAAACGCGAACACCAAATTGAAAGTGTTAATGACCGGCTGACGTAGAATGGTATCACACGAAT
GATCAAGCGTTTATTCCAGATAGTTTTGTCAAAGATCACAGAATCTCGTAACTCTGCATCTCCGACGAGGAAAATGCGATAAATTATGCCGAGATGGTCG
GCAAGCAAAAGGCACAACACAGGCACGACAAAGCGAACATGAAGTTTAAGCATATATCGCGTGGATGGTGTCAAAGCATCCAACGTAAATGCCCATTGAG
CCCAAAGCCACCACGATAATACCATAAGACAGCGCGAAGTATCCCAGCTGTACAAGACGCAGACACCGATGTCTGCACACGTGACTTGAAACGAGTAGAA
CGCGAAGTCAAAGGAGGTGAAAAGTAGTTTTAGCAATTGTCGTTGGTAGAACACGGCAAAGAAACCTGTAAATACCGCGGTGCACAGCAGCGCGATAAAA
CATACCATAAATTCAACCTCTACTTGTGCCGCAATACTTTCCGATTCTTCGAATTCGTGAAAGAGGGGGATATGCGCGAGTATTAAACCTACCGCTCCAA
TAGTGTAGACTACCAAAAGCAGCCAAGCAGGGAAAAGTGTTCGTTTAGCTACTCCACAAGGTAGTAGTGTATTTGTCGCCTCAAATTTCTGTGGGAACTT
GACAAACATCAAATGTTGGATTACATCCGCATCGCGTAGCGACGTTTCTTTTGATTGACATCTTGAGTCTTCACTGGGCCATGCCAGCGAGGCTGACGGT
CCCACTGGCTCCAGTTTTAGTTTGCATCGATATATAACACACTCTACAATTGCTGATGATCTTTTCGACCCCACTCGAAGATTTTTTCGTCTCCGGAAGA
CAATTTTGGCAAGTAGAAAGCCCAGTGACACTAGACAATTTCCAATTACATCAATACCAGAGAGTTCAAAACTTCTGTGACGATTCTCGTATTTCACAAT
TGTAAACGTTGAAGCACCATCTACCTTTCCAAGTATGATCCAAACGAACACAACAGTAACAGACAATATCGTAGCGATTAGGTAATAAGTGAGACTTCGG
AGACCCAACACATGCGCATCGACAAAAACCACGTGATGGTATCCTATCCAATCGACTAACATTCGAACCGAGCGTAAATCTCCAAAGTACATTGACATTG
TGACTGTGATAATGGTAGTGATAGTGGAGAAGAACCAGAAGTCAAATGTTCGAGACACCAGGCACACGATGTCGTATCTCAACGTCGTCACACTACCCAA
TCCAAGTGGTATCCACAGAATAGCCGCCAGTACTGCAATTATTCGTCCCATTCGCGCTTCGACTAATGGAACCAAGACATTTAGACAATGTGATGCCGCA
GCGCAAACCAGAACAGATCGGTGGTACTTGTAGTACTTGCGACGGATGAACGTGTGAATTTTCGCAGGTAATAGTCGGTCGCGAAAAGACTTGGACAAGT
CAACTGCAGGAAGAGGTTGAGCTGGTACCAGCGAGTAGATAAGGCTGCACGGTTGACTGATAACCTTGGTTTGGAGAGGCATTGATCAGA