Description :
From Genome Similarity Track
Location :
contig_140:14959- 17310
Transcript NameFunction/comments
g13749.t1hypothetical protein

Sequence
2351 bases(100 bases per row)
CCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCCG
TCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGT
GTGTCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTCACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCAGGGCAGCAATCTC
ACCGTCTTGGCGAGTACTCGAGGTAACTTTTCCTCAGCCACCGCACTCGAAACCCAGGCTTCGCATTCACTCGACCCGCTTTCTTCATCTTCACTCACAT
CGCCTCCACCGAGGTTTAAAACTCTTTCCTTTTCATTGTCAGTCCATGTCACTCTATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACGTACGC
GTAGATACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAA
ATACGAGGGTCTGGAGCTCGGGCGAGAGGTCCTTCTTGTCAACCTTGTTCTTGACGAGGTTTGCGAGTTCTTGGAAAGCTTTGCACTTGCTCGCATAGTT
TGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCAGTCTCGACCACGAAA
ACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAGTTCGTCGTTCGCCT
TCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAAGTGTTCGTCATCGC
TGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTCAACGTGGCTTCGGCCAA
CATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAGGATCGTCAGTGCGCCGG
TCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACGATCTTCCATCTTCA
AGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCACACGTCTTTAAGAATCG
TCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGTAATCACAGATGTGTTCT
TTGTCCTTCCGTTCCGCTGAATAGTACCGAGTCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCATTGAGCAGCTGCCAGTCGC
GCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCACCACTCATTAGGCGGGGTATGCGTCCC
TTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTCGCGGAGTCCGAGGTACGGCTTGATCTGAGCGAGGGGTCGATGCGTT
GCAATCTCGAGTTTCGGTGTAGCATTCAAACTTTCCATATCGCTTGCTTCACGCATCTGACGCGCAAATTCAGCAGCTAAGTTGTCACCATCCCCATTAA
AATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCCAGGACGTCGTCCGATCCTCGTTTCGAGTTCCGCGCTGGGTTT
AAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGGAAGTACGGGGAACGCTCGGCCGACGTGG
CGAATGCTCCACCCAGCTGTTGTTCACTTGCACCGGTGCCTACATGACGCTTGGGTGTTACGGTAATGGTATCATCGATGGGTCGACAGTTTCCCCAGCT
TTGCGCGCCACTGGTTGCCTTCCGGTACGATCGGTAGCCCCAAACGCAATACGGAGCTTCTTCTTCCATTTCTGCAATTCGGCTCCAGCGGCCGATGGTG
ACAAGTCTTTCAGGATCACATCCGAAGGGTACGTCTGCGTTTCCAAGCCCA