Description :
From Genome Similarity Track
Location :
Scaffold_1:14953- 16766
Transcript NameFunction/comments
Aphas_H257_00007heat shockprotein A

Sequence
1813 bases(100 bases per row)
CTTCTTGTCTTCGAGTTCCTTGACCGTGGCTTCGGTGTGGTCTTCCAACCAGTCGCGGGTTTCTCGCAGCAAATTTTCAGCGGCCGCTTCGCCTTTCTTG
GTCGCCACTTCGAGGTACCGGTAGATGAACCCTTCCAACTCGTTGCGCGCTTCGATGCGCTTCAACAGCAAAGCGTCCGCCTTCTTGTACTTCTCCGCCT
CGTCGACCATGCGGTCAATGTCTTCCTGGCTCAACCGGCCGCGGTTGTTGCTGATCGTGGTCTGGTTCTTGGCGCCGGTCTTCTTGTCCTTGCAGCTCAC
GTGCAAGATGCCGTTGGCGTCGATCTCAAACGTCACTTCCAATTTGGGCTCGCCGCGCTTGGCGCGCTCGATGCCCGTGATTTCAAACTCACCGAGCTTG
TTGTTGTCCACCACCGACGCGCGCTCGCCTTCGTAGATGACGACCTTTTCCGTGGTCTGGAAGTCTTCTTCGGTCGTGTAGATGCGCGTCTTCTTGACCG
GGATCGCCGTGTTGCGCTTGATCAGCACCGACATGACCTTGCCCACCAACTCAATGCCCAGAGACAAGGGCGTCACGTCCACCAGCAACAACGAGTTGGT
CGCGTCGTTGCGGATGCCGCTCAGGATCGCGCCTTGCACGGCCGCGCCGTACGCCACGGCTTCATCGGGGTTGATGGACTTGCTCAGCTCCTTGCCGCCA
AACAGACCCGACAGCATGTTTTGCACCTTGGGGATACGCGTGGACCCGCCCACGAGCACCAGTTCGGTGATTTGACCGGGCTCCATGTTGGCGTCTTGCA
ACACCTTCAACACGGTTTCTTCCGTGCGCTTGAAGCACTCGTCGTTGAGCGACTCAAACTTGGCGCGCGTCATGGTCGAGCTAAAGTCCACACCTTCGAA
GAGCGAGTCCACTTCGATGGTGGCGCTGGTGGTCGTGGAAAGCATGCGCTTGGCAGACTCGCACGCCGTGCGCAGGCGGCGCATGGACCGGGCCGACGTC
GTCGGGTCCAAGTTCTTGTTCTTGCGCTTGAACTCGGTGATCAAGTAGTCGACCATGTTCGAGTCAAAGTCTTCGCCACCCAAGTGCGTGTCACCGCCCG
TGGACTTGACTTCGAAGATGCCGTTCTCAATCGACAAGATGGACACATCAAACGTGCCTCCGCCCAAGTCGAAGATCAAAATGTTCGACTTGCCTTCCGC
GCCGGCGTTCGTGTCCAAGCCGTACGCGAGGGCGGCGGCGGTGGGCTCGTTGATGATGCGCTTCACGTCGAGGCCAGCGATGGCGCCGGCGTCCTTGGTG
GATTGACGCTGCTGGTCGTTGAAATACGCAGGCACGGTCACCACGGCTTGCTTGATCTCTTGGCCGAGGTAGTTTTCCGCGGTTTCCTTCATGCGGGTCA
GCACCATCGACGAGATTTCTTCGGGGGTGAAGCTCTTGGCTTCGCCGCGGAAAGACACTTCGATCAACGGCTTGTCACCTTCTCCCTTGGTAATCTTAAA
GGGGAAGTGCGCGGCGTCCTTCTTCACGATGGGGTCGCTAAAGTTGCGGCCAATGATACGCTTGGCGTCGAACACCGTGTTGGTGGCGTTGGACGCGGCC
TGAAGTTTAGCAGCTTCACCGATCAAGCGCTCGGTTTCGTTGAACGCCACCCACGAAGGGGTCGTGCGGTTGCCTTCGGCATTGGCAATGATTTCCACTT
GGCCGTCCTTCCACACACCCACGCACGAGTAGGTGGTACCGAGATCGATCCCGATCACCTCCGAGAAACCACGCTCGGCGCGCTTGGCGCTTTCTTCGCG
GTCGGCGCGGGCC