Description :
From Genome Similarity Track
Location :
contig_76:149512- 151926
Transcript NameFunction/comments
g10082.t1hypothetical protein

Sequence
2414 bases(100 bases per row)
ACAAGTTGAAGTGGAAGACAGATCCCGCTTGAGCTCCGCGTGACCGCAGATTAACGCGACTGAAACACGATGAGTGGTTCCTCTTGAAACGAGACCTCGT
TCACCAGTCGAAATAGTTGAGCTGGCCTCGGTGTTAAGGTGGTACATGTAGCAGTTGCAGTTGCAGTCGTCGAGTTGACTTAAGTGAGAATTAGTGCTGA
TACAACTTGCTGCATATTGTGCAAGTCGAGACAACACAAGCCGCGCCTCCAATGTCCTGGACCCTTGTCAGGAGTCGTAGAGTCTTCTGGAAATCTAAAC
AATCGCCTATCACTGTTGTGAAGAGACGCTCCATATCCAAAAAGTGAGCTGCTAATCACCATGGCGTTCCGCTGCGCTGGGAGTCCGCTAGACGAAATGA
AGAGGCTGGAGAAGTTGCGTGAGCAAGACCCGGAGTCTGCAGCCAACTTGGTGGCCAACGGGAAGCTCCTCGTCGCTTTTACCCACGACGGGAATCTGCG
TGCACTTCAATGTGCAGCTGAGCAGCTAGAGGAGGTACGACGACCTGCAACCACTTTCTTCCTTTTGTTTGACGCGGATCATGTCTTGACTGATACTCAC
TCATGACAGGGGCAAGTGCTCATGTTTTATGTCGTGCGGATGTTCCGCGAGGCCTGCTCGACGAGGAGACTGGACATCCTGCGATTCCTGCTGCTCAATG
GATTCGACCTCCAGCAAAGTTACACGCGAGATGCCTGCACGGGGTCATTGAGAGTATTGACAGTCCGCAAAGAGCTGATGCTGTACAACCCCTCATTCGG
TTTCTCCTGGACGCTGGCGTCGACGTCAATTGGCAGAGGAAGTCCGACCTGTACACGGCACTACACGTCGCGTGCTGCAAGAACTTGTACCCCATCGTGT
ACTTGCTCGTTCTGTACGGCGCCGACGTGAATGCCATCGCTGCGGTGGGTATTAAAGTGATACAAATTGAGTGCAAATATCGCTAGAAATGCTAACGCTG
CTTTTGACTGCGATGCTGCAGGATGATGCCATGCCGCTCGCGTGTGCAAACAAAATTGGCGACACGAGCACTTTATCAGAAACTGAACAATCGCAGAAGG
AAATGCTCGTGTCCTTTTTGGTGGAAAACCAAGCACGAGAGACCTGGAGAAGGCAACCACGTCGAGTTACTCCAGCAGCGTCGATGAGTGCGAGCTCGCC
CAGCCCAGAAGCTGGTGAATCTGCAGTAAGTCCAGTCAAACGACCGATCTTGAGCTTTTCGAGTAGTTTCGGTATCCACTGTAGCATTGACGAACCGACA
GACAACCAGCCCCAGGAAGGTCTCCGATTTGACACATCGGACACCTCCGAAAGCCTGTAGGCGTTTGCAATTAGGTGGTTTCACCAGCACCCGAGAAATG
AGATGCAACAGAAACAAAAATACAAACTTGACTTGTTCAAGCTGTCCTTTAACCTGTGTCGGTCTCTTGCTTTTCATAGCTCAGCATTCTTTGCATCTGC
GGGCTTCATCCTAGAACTTCTTACGAACCGCGGCATCACACATGTCGTGCAGCCTCATTGAGGCCAAGTTCCAGGTGCTGGACCGCACCATCAGGATGTT
GTCCAAGTCCAAAAGCTTGCGCACGCCGAAAGTCGCGTCGTCCGAGCAGCTTCGCGATCTTGTAGAAACCCAGAAGCCGACCTCTCTTCTGCCGACGCTA
AACGCTGTGAAGGGCGTAGTGGTGACACGAAACAACCAGACGTACCCGACCGGTGAGAAGACAAGTCGATCGCAGCCGAGTACTGCGCGCGAAGAGAAAT
CTGAAAAGAGATCAGGACACTCACCACCACGCCCAAGCACTGGGAGGAGAGATCCATACGAAAGCTCGACCGAACTGCTCCCAGACAAGTGGGTCGACCC
AAAACAACGGCGAGCAGAGCAGCTTCTGCAGGAGACTTGGCATGTACGTCTCGGATTAGCTATCAGAGCGATACTATCACCTAACTGTATGGTTTGCACG
GCAGGAAATCGAGTCTGCTGTAAACTGGGGTCAAGAATTGGGCTCTCCCACTCGAGAGGTAGGCTTGCGGTTGGCAGTTCGAAGTCATGTGATCCTGACT
AATTGAACGGCGATGTCATGCTCTAGGCGCTTCGGTCGAAGTTGCTCAACGAAAGTGTACAAGATGATCGCCAAGAGCAAGAGTCGATATCAAGCCAGCG
TCAACTACTAGAGCAATATGGATAACCAAATTAACGGCGATTCAGGTGAGCAATTAGACTATCGATTCACCAAACAGTTTGCTGACGCTGTTGCTGCTTC
GACCCTTCTGTCTATTGGGCTATAGATGCACTTAGTGCTGCAGTGCACAACGCTTTGCCCCCACCAAAACGACCGCTGACATCAACGGGTTTGCAACCGA
AGAAGAGCAAAGCT