Description :
From Genome Similarity Track
Location :
contig_62:149506- 152257
Transcript NameFunction/comments
g9237.t1hypothetical protein PHYSODRAFT_301780

Sequence
2751 bases(100 bases per row)
CGATTTCCCGCGCCTTAATGGCGGAATTTCGTCATCTGGAAGACTCGAGTGACCGCCGCCCTTGAAGGCAAGAATCTGATCGGCTTCGTCACCGAAGCCG
ACTACGCGGGCGACGAGGACTACGACTTCTCCTCCGATGAAGACCTCAACCCGGCACTGGCCGACATGGGGGACATTGAGGCCGCACTAGATGCCGTTGG
GGCGCCCAAAGCCACCGACATGGAGGACTCCTCATCGAGTGAGTCCTCTTCCGACTCAAGTTCGGAGGCTGCCACCGCTGGAGACGACGGCGACGTGGAA
ATGGGGCAGGTACAACCACCCTTGATCCAGTCATTCACCGCTAAAAAGCGTGATGATCTGAAGCGAGCTGAGAAGCTAAAGGCCAAGAGCCTGAAGCTGA
GCTCGAGGAAACTACGGCTCGATGAAGCAAAGGCTAAAGCCTTCCTCATCAAAACCATCGATGATCAACACGTTCTCATGGTGAAGGACAAGACTACGGC
GTACGAAATCTTTCAAACGCTCTGTAGCAAGTACGAAGGTGCTGCCATCCACGGTGACCCGTACTACATCCAGTCGTACCTGATGGCCCTCAAATACGAG
GAGGGATCCGACCTCATGGCTTTCATCATCGACTTGGAAGAATCCATGAAGGCAGCCGCGGAAGCCACGAACAGTGTGCTGAGCGACGAGCAAAAATCGC
TCTATCTGTATCACTCTCTCCAACGGAGTGGAAGCCTGAACTAGCAGTCTGGAAAGGCAGTCGGAAATTCATTCCGTACGAAGACCTGAAACGGCACATC
GAGACCAAGGTCCAGAATGAGCTAGCGCGCAATCGCTACGTCCTCAGACAAGGAACCCCAGAGTCTAAGGAAACACGAGCTGAGAGAGCTCTTCGAGCCA
CGGCACCAATTCCGATGCCAGCGGATCTCCAAATCCCCGCCAAGATGGAGACAGCTCTCGTGGCTTCATTGAAGTGCACGTACTGCCAGCGTGACAACCA
CGACACGGTCGACTGCTACATCCTGCAGCGCCACCTACGTGATGGCCAAATCAAGGCTGGTACGGTTCTGCCTGCCAACTTTAAGCTCAAGGCACCACAA
GGCACGCAAAGCCATCATCCTTACAAGGGCAACTACAAGGGAAACCGTGGCAACAACTCGTGGACAAACTATCATGGTCGTGGAAACAACAATCGCGCTC
CTAATGGAAAACGCCAAGATCGCCGTGGAAATCACAGCCGCAACAACCAAGGCAAGCAAAACGAATTTCACGGCCGACGCAACCAAGACGCCCATGGATC
GGACAACAACGAGTATGGCATAATTGCTATTACAACGCTCGATTGTTCCCCAAAACTGTGGAAGTGAGTCTCACTGCTCATGTCGGACACCATGATCCAT
CATGGACGATCGATTCCGGCTGCACTCGCCACGTCACGTCCAACAGAGAATGGTTTGTGACCCTAAAACCGACCGCGGGTAAGTCCATCACGGTGGGGGG
CAATCACCAGATTCCCATTGCAGGAACAGGTGACGTGAAGCTATCCATCAAAGATACGAAGGGAAGAGACAGAGTCATTACCCTGATCAACGTGCTGTAC
GCACCTGACCTCAAGTTTAACTTGCTCTCAGTTCGTCAAGCTGTCGAAACGGACTACAAGATCAATTTCCCGAACGCCAAGAAATGCGTCCTGTTCTACG
ACCGTGGAACCAAGTTCGAAGCCAAGACTGGCAATGGCACTCGCCTCTACCAATTCGAAGCTCGCCCGGTGAACACCGACCACGTAGCCCATGTGGCCAA
ATCTGGTACGTCCGATAATATTTTACTCTGGCACAAACGAATGGGCCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAAGCAGACGTTGTCACAGAC
ATGGGGATGTCGAAATTCGACTCAAGCAAAGACTACTTTTGCTCCTCATGCACATACGCTAAAGCACATCGTAACCCATTCAATAAACGTACTGTTGAAA
GGGCAAAATTCCCTCTTGAAAAGGTTCACACAGATATGGCTGGACCCCTTCCTGTGCCAACACTATCAGGATGTCAATATTTCTTGACCTTTATTGATGA
CTACTCGCGCTATATGTTTATCTACGTTATCAGGCGCAAGTCAGACCTTTATGGCTGCTACGAGGACTTCAGAAAGAAAGCACAGAACATGTTTCGCGCT
GATGTGGGTCACTTAGCATACGATGCTAATATGCACGATGAAGAAATCCGGAACCTCCAAAGTGACAACGCTCGTGAATATGAAAAACTCGGCAGAATTA
TCTTCGAAAAATATAACACCCACGCACAGTTCACTAATGCGTACACACCACAACAGAATGGCGTGGCAGAGAGGCGTATGCGCACACTCCTTGAAAGAAC
GCGAGCTTTTCTAATTGACGGAGATCTTGATCAACTCCTTTGGGGCGAATGCATCACCCACGTCGCTGATCTCCTCAACATGACCCCGAGCTCGGTCACA
AACAACGTTACTCCCCATGAAAAATGGTTCAAAAAGAAACCATCAGCACACTACATTAAGGTTTTTGGCTGCACGGCATACGCTCACGTCCCGGAACTAT
ACCGCAACAAACTCGAAAAACGGGCTAGAAAATGCATGTATCTCGGAATTCCATCCAACAAGAAGGGCTACAGGCTCTTAGATACGACAGAGAATCGCAT
CATTTACAGTCGTGATGTTACCTTCCGCGAACATGAATTCCCCACGCTGGA