Description :
From Genome Similarity Track
Location :
Scaffold_919:1495- 5034
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_919-snap-gene-0.6TRNA wybutosine-synthesizing protein
Pytar_ATCC12531maker-par_contig_919-snap-gene-0.7TRNA wybutosine-synthesizing protein

Sequence
3539 bases(100 bases per row)
ACGCATCGGATATCGGCGACCAAGTGGTACACTTTCGGCGCGTACGACTTGACCTTCTCGACGTGCTCGCACGTGACGCGCCAGCGCTTGCCCTGCTGCT
CGCCCAGCGTCTGGATGCTCTCCACGACGTGCTGCTCCCACGTCTCGCGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCGTGGACATGCATCC
AGCCGCCCTCGGGCTTGAGCACCATGGCGGCGAGCGGCCACGCCTTCTCGCTCGTGGGCAGCAGCCCCAAGTTGACGCGGTCGGCGACGGCGCCGATCGT
CGGTNNNNNNNNNNCACTTGGTTGTCGCCTTCGTAGATGCGGCATTTGTGGGCCACGTGGTTGCGCTCGAGGTTGAAGCGCAGCGCGTCCACCGAGTCGG
GGTTCCACTCGCACGCGTGCACAAACGCCGCGTTGCCATGCACGAGAAAGGGCACGACGTAGTACCCAATGCCGCAGAACAAGTCGACGATGGTCTCCCC
GGCACAGCCGATCGCGGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCTCGGTCACGTTGCCCGAGGAGAACATGACGCGCGTCAGGTCCCA
GCCGTACATGATGCCGTTCTCGCGGACTTCGACCCAGCCGTGCTGGCTCGGACGCGACGATGTGGACGACTGCATGGCGTCCGTGTCGACGAAGAGCAGC
TCCACGCGGCTCTGCCGCTTTTCGCCGGCGTCGATGAACTCCTTCCGGGCCACGCGGGACAGCTTGGGTGTCGTGGCATGACAAACGGCTTTCCACATGG
AAGTCGCGATCGCCGTCCACTCGGTCGCCACGAACGTGCCACGTGAAACAAGCAGCACGTCGCCCACGAACTCGTACTTCTCTGGAATCGCCGCGACCAG
CGCTGGTGGGACTGCGTGGCGACTAGCGAATTGCTCGATCGTGGACCGCACGATGTCGTTGCGGCTCACACCCGAGGCCTTGCCAAACTTGTTGCGGTAC
GCGTCGTCGTCGACCACGATCTCGAGCGACTCGAGTTCACTGTGGCTCGAGCGCGCCGACGAGATGGCCGGCGTTACGGGCAGCAGAAAGGCCGGGCCGC
TGGGCGACGCGCGGTCGGCGACGACGTGGACGCGACGCGACTTGTCGTAGACGCCCACGGCCTCGAGCAGCGTTTTCGTGGCTTTGACGTGGGCCTTTTG
GGCCAGGACACCGAGTGGTTGGGAGACGTCCAACGGCGTGATGGTGGCCGTCGTCGACTCGGNNNNNNNNNNNNNNTCGGCGGCGAGGACGCCACGCCGT
CACCACCGCCTTCTCCACCGCCTTCTCCACCGTCAGTGCCAGCGGCAGCGCGAGACGACCCAGTCTTCGGGGTGGTGGGAGTGGCAGTGGGGCTCGTCTC
TCCCTTGTGGACGATCACGAGCTCGCACGCAAAGGACGATGAATAACACTGGCCGAAACCAAAGACCTGGAACCCTCCACCGAGCACGAGCAGCTCCTTG
CGTGCGGGCAGCCAAGTGCCGGTCGAGTACACGAGTGCCGCGCGCGCGTGGTAGTCACTCGCCGAGCTGTTGCTGTTTTCAATCGCACCGAGCAACTGCC
ACTCTCTCGTCGACGTGCTGAGCGAGTAGATCTTTTGCGGGGCGTTCTTGCTGCTCTCGCTCGAGCTCGCGGCGCTCGTGCCGCCACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGTCCGGCCGACGGTCCGTGCTCGGCGTTCTTAATGAGCCGTTTCTCCCA
CACGAGCGCGACCGTGTCAAAGAGCCAGAAGACATCGCGCCGCCCGGCGTCCGCACTCGACGTCTCGTCGAGCGACGCGAGTCCGCCCCACACAAAGAGC
TGCTTGGTCGCCGGGATCGAGACGCCGACGTGGTCGAACCGCGCGGCGGGCACCTCGGTGCACTCTATTTGCAGTACGTTTTAGTTAAGTGAGACCAACG
TGAAGGAAGGATACCTAGCAAAGGATAATATGAGAATAGAACAACGTACCAATCTTGCGCCACGTGGGCTCGGCGTCTGCGAGGTCGAGCGCGTGGAGAT
CGTTGAAGACGGTGGACGCGTTGCGACCGCCATAGACGTACATGGTTGTCCCCACTGTACCATAAGAGACAGAACACTGTGAGCCCTCTCCCCTCTTTCT
CCATTCTCTCCCCAAACGTACCAACACTGCACGAGTGCTTCCACCGTGCCGCCGGCAGAGTCTCGCCCTGCACGACCACCTCGCGCCACGCTTTGGTCGT
CAAGTCGCATGCGTGGACGTCCTGGAAGCACTTGAGCGGACCCGCGCGACCACCAAATATGACCATCTCACCACCAATGACCACGGCCGAGTGGTGCATG
CGCGCCGACGGCGCGTCGCCCGTGGTCTCGACAGTCGCGCTGCTGTGGTCGTCTTCCTCGGTGGCCACGACCACGAGATCGGCCAGTCGCGACGTCGTGC
CCGACGCGGCCTGGCCCTGGCCACCAAACACATAGACGCTGCCGTCATAGTGCACACTCGAGTGGCCCACACGCTGGAGCAGGCGGCCCGTCTCGGTCGT
GAGCGGCAACGCGCGGCAGCGCCGCAGCGACACGGTGCTGGCCGCGCGCTTGATGGTGTTCCTGCGCGCGTTGAGCGCATCGTTGGCGTGCGTTGGCGAC
GCGATCGTAAAGCTGGTCGTCGCGACAAACTGCTTGTGGAACGCTGCGCAGAGCTGGTCGGTCTTTTTGCGGTTGGCGGCAAACTTTTCGTTGGCAATGT
CCACGATCCACTGGAGGTACTCGTCACTCACGGACAGGTTCTCGACCGAGCGGCCCAGCGGGATCTCCATGGCGTTGGCGGTCGTGCGGATCGCGCACAT
GATTTTCTTGTTGCCCAGCACGACGCCCGACTCGCGAAAGCCGCACGCGAGGCCGCACTGCAGCAGCGCCTTGGCGGCGTCCACATCGCGGCACACGACG
TGCATGATGAACGGCTCGTGCTTGAAGAGCACCATGTTGCTGGCGACTGCACTGTCGCTCGCTTCCTCAGTGGTCGACGGCGCCAGCGCGGCACGCAGCT
GCTCCATCGTCACGGGCGCGTGCTCGGCCAGGAGCCACTCACCGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTGATGAGATG
GTCCGACGTGCCATTCGCGTCGCCATCACTCGCCGGCGCGGCACCCGCCGGCACGCCACGAAAGACGGCGATGCGGCCAGAGCACGAACTACTCGTGACC
TGGTCGTATGCGCAATATTGGTATTCAGCAGATCCAAAAAGAGAAGAGAAGAGAGGGGGGGAGGGAATAAGAAATAAAACCGTACATAGTTGGCATGGGC
ATTGATCATGTGGATCATGTCGAGAATGGGCGCATCGACGCTTCCCTTGGGGCTCTTGTCCTCCATGTCGCGGAGCTTGCGCAGACTCTCGCGCTTGAAT
TGGTCAAACGCAGCGGTCGCGAGCGGCGTCGCCATGGTG