Description :
From Genome Similarity Track
Location :
Scaffold_890:14947- 17867
Transcript NameFunction/comments
Phypl_g11484hypothetical protein PHYSODRAFT_335121

Sequence
2920 bases(100 bases per row)
TCGACCACGTAGGACTGCATCACCTCAAAGCGATTTAGGCTGGTGGTGTTCTGCTCAAATTCcctcagcagcgcgccaCAGTTCAAGTCAGCTTCATCCA
CCCACGCCGGCTCGTAGTACCCTTCCAGAACCCCTGGAACTCCCGGTATACTCGCCCGTACCGCGTCCTACGCCCGGATCGGACACCCGCGATCCGCTCA
ActtcgaactcgtcctcgtccagtACTCTCTCCCAACTACCCTCCGGCAGGAGTGCCTCATCAAAATCGAATCGGTCGGATTCGTCCGTAGCGAGCGACG
TCACCGGCCGATCAGGGAAGACCCTGACCAGCTTCAGTTTGGACATGTGCAGGATCGGGAAAATCCTGTACTCCGTACCCGCCACGTCCAGTCGTGTGGC
GTACCCATCAACCATATCTGCCACGCGGAACGGACCGTGCCACAtgtgcgccagcttcttcgtgtagCCTTCCTTCCCCCGATCTAAGAACAGCCAGACT
TGTGATCCGGCCTCGATCTCATGCGGCCGCACCTCGTCGTTGTGCTGGTCGGCTCGGACTTGGATCTCTTCTCGAAGACGCTCGCTGACCTGTTCGCGGG
CGCGCTGGTACTGCACCTGGATGTGGTACCGCCGTCTGCGCGGATCTGGGTCGCGGCGACGCGTGCTGCCTAGCGGTAGCGACGCCTCCAGTGTTGACCT
CGTGTCCCAACCATGCACCAAGTAGAACGGGGTGTCGCCACGAACTCGATCCTGAGCGGTGTTCAACGCGAGCGTGAGATGCTCCGCGTACTCGTCCCAG
CTCTTTGGCTGACATCCGCTACGCACATCTTGAGCGCGCGCGTCAGTGTCTGTACCATGCGTTCCGCCGTACCGTTGGCCTGCGGTCGGTGCGCCATCGT
cgctctctgctgctggcctacTATACGGTTGAAAGCCCGGAAAAACTCGGACATAAAGCCGGGTTCACGATCATGCTGGATTGCCGCACTCGCTCCGAAG
CGCCGAAACACGCACTCCTCGTAGTTCTTCGCGATCGTCTGCGCAGTGCGCGAAGCGCTTGCCTTCGCGATCACGTACTCGGTAAACAAGTCAACCCAGA
TTAGGAGCTCGGTGTTTCCCTTGAACGACTTCCGTAGCGACGAGATGTGGTCCATTGCGACTATCTGAAACGGGTACGTGGATCGCATGTCCCCCGGTGA
TTCCCCCCGGATGAGTGGTCGTCCCTTCCCAGTCTCACAATCAACGCATTCTCCCACAAACCGTTGAACACTCCGATACAGACCTCTCCAGTGAAAGTGC
TTCCTGATCCGCTGGTAAGTCCTCCCAATACCTTGGTGCCCGCCTTCCAGGCTTGCATGGTAATGATGGAGGAAGTCTTGTTGCAACGTGTCAGGTACCA
CCAGCCTCGTGATCGAGTCCCGATCTTCATCAGCTTGCTTGGCCACCGGGCAGAAGAACAGCAGATCGTCCTCATCCAGGTCGTAGTCGCCCGCGATCTT
GGAGCAGGACTTGGCTTCCGCGGTGCTAAGATCGGGCACGTCACCCCGAAGGTACGCCTTCAGGTCTGCGATCCACTTCTCCTCGTTCTGTGCATGGACA
ATGCACTCACCTCTCATGCGTTGCACGATTGTTTCTTGCAGGACTTCGGGCTGCAGAGGCCTTCTTCCTGCCGAGCTAGTGACAGCAGTCACGCGGACGA
CCGTGTCAGCCGCCTttgtcttcagcagctcgtccagctggtTGAGCGTGATCAAGTCCTGACGCTCTTCCTCCGAGGTAACcactgcgccttcttgacc
ttgTAACGCGGCACTTGCTAACCGATCAGCGCTCCGATTCCAGTCGCGTCTCATGTGCAAGAGCTCATGCTTCGGTCACGATCTaagcttctccagcgcc
ttctgtCGAAGCAGTTGCAGACCAAGCGCATTGCAACCGATTTCGCCCCGCATTTGCCTGATCACCAAGTTGGAGTCTCCACAGATGATCAGTCGCCCCG
GACAGGAGATCGAAGCACAACAGCAACCCTCGATACTCGGCTTCGCTGACCGCCAGGTTGGTCGTGTATTCCGACGCCACGGCGCGGATCGTCCAGTCAG
GGAGTTTCCAGACAATTGCACTATAGGCTCCGGCCTTTCGCTTGGCGCTCGCGGACCCATCGAAGCTGACGACCAGCAGATTTTCATTCTGATCGACTGT
CGGTGGCATCATGGCGACTATTTGACGTGACTGTTTCTTCAGCGCGATCGCGATCAATGTCTCATCGACTTCGGATCGAGGCGTGATGCTTGCTGCGATC
GTGCCAAGGATTTCATCCTCGCCCTTCGTACACTTTCGGATCTCAAGTGTCCATTCAGAAAGCAACGCCGCCCATCGGCCAAGTCTACCGTCCAGTCCAG
ATGAGTCCACCAGCCACGCCAGCGTCGAGTGAAGCGTCAAAACTTTGATCGACCGCGTTACGAGTAACATGTAGCAAACGTTCAAGACTCGGAGGAGGGC
CAACGCCTCTTTATCGACCATCCCGTAGTTGATCTCGCTTGCCTTCAAGGTACGGCTAGTAAAAGTTACTGGCCAGTATACACCGTCGTGCACCTGCATT
AGCGCCGCGGAGATCGCCCATTTACTGGCGTACACAACCACGACTGGAGTTCGATCCGAATCAAAGCGACGGTGGACGTGATCTTCGCCTTTAGCAACGT
GAACGCGACCGTCGCTCTCACCCAAGCGGTCGTCCTCTTCAGGTAGCAGCGTGGCACCCCCTGTTTCTCGGTTCCCGGTAACCACCTCGCTTCGTCCGCG
GAATTCGTGGAAATCCACTTCTCGCAGCTCGTACAGAATGGCAGCGTAGATCGCGAAGCCCTCTGTGAAGCGGCTATAGTAGTTCAAGCTGCCCAAGAAA
GACTGCATCGATCGTAGCGT