Description :
From Genome Similarity Track
Location :
Scaffold_614:14945- 16048
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_614-snap-gene-0.13Voltage-gated Ion Channel (VIC) Superfamily
Pytap_DAOMBR444maker-pag1_scaffold_614-snap-gene-0.18Conserved gene of unknown function

Sequence
1103 bases(100 bases per row)
TCGTACCAAGCGCACAACGACGGCAGTCGCACTGTCATGGGTTCAGATCCACGTGCTCTCAAGGCAAGACCTTGATGAAGTGAAGGACCAATACACTGAA
GAGGCAGAGAGCCTCGAGGACGAGATCAAAATCGACATGAAGTCACGGTTGTCCTGGCGTGAAAGACAATAGAGAATGCCAGTTTTGTCATTCAGCACGT
ATAGAACGTGCTTGTTCCTAATTGTGAATATGTTGATGAGTGCATGGTTTCAAACGAACTGACTGAAGCACCCTAGAGTGTTCAGAGTTCAGCCACCTTA
GCCTCCTGGAACGCCGCGATAGCCTCTTCTCGGGCTGCTTCCAGCACATTCTAAAAGTCATTTATGCACAGAGTCAGTTCCAGACCCcGCCGTTATCAAT
GACGAATCGAACCTTTGGTGTAGACTGACTCTTGATTGCCACCTTCGGCTTTGGCACCTCAACTTTCTCGTCATCATCCGTGTCGTCATTCGCCAAACCT
GACTTCTGCACGTGGTCCTTGGCTCTCGAACGAGCTTGAACGTATCCTTCGTTGCATGCAGATACACGCTCTGCAGGTGGGCGTCCACGGAAaTCAGTGC
ATGCATCTAAaCGCAAAGAATCGAGTCGACGTTCATTTGGCTCCTTGCTGCAGAATTCgAGGCATGATGCCTCTCGACCTAGGCATCCCATTCCATCGGT
AAGCTAGTACCACCTTAAGGTGAGCTCTCTACCATCATACCCTTGgTGTAGCCCGATTGACAATGATTGTACAGATCTGGACGAGGCAGCTCTTCCCGCC
AGCGACGACAGTCAGCTTCGGATGCCTCGAGCAGACGAGTGCGACACGAAGACACGCAATCTCCGCGCTTGGCCTCTGCACTAAGATAGAGGGCGCTTAG
AAGCGCTGAGAGCAGCACAGCAATGGCCTTCATAGTtGTAGAGTTGATTCGCGTAGGCAGGGGAACGCAGAGTGAGCAGGTGGCGTGTGGGCGTCGAGAG
TGCGAAGCGTCGGCGGTGCGTCATGAGAAGATCGAAACCCACGCCTCTTCGCGGCCGAAAGCACGAAGAATGAATGTTATCAATAACATATTGTCATACA
GGA