Description :
From Genome Similarity Track
Location :
Scaffold_129:14944- 17038
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_129-abinit-gene-0.28Conserved gene of unknown function

Sequence
2094 bases(100 bases per row)
GAACCGCGCGCTGCGTCGCCTCGTGGCCGCCGAGGAAGAGACACGGCGAGAGAAGCGCCAGCGTCTGCAGCAGATCCTCAAGCAGCGTATCGCCGACGCG
GCGGTAGCGTCTTCTATTGGAAGCGGCTCGGCGACCAGCACGCCGGCGCCAACTTCTGCCGCCGAAACGGATGCCGCCACACAGGACAAAAAACCAGCGA
CTGCGAATGGCCACGCCACTGATGACGAGGAGGAAGAAGTGATTGAGCAGCAGAAGCTGCTGGCCTCGGCGTCGGCGCACTGGCGCTGCGTCGAGGACTC
GCAGCAGGCCGTGTGCAGTGCGCTGAACCGCCGGCAGACGCTGCTCGCGATCGGCGAAAAGGACGGCCGCATCAGCATTTGGGACAACACGACGGTCCGT
GTGATCACGAAGGAACTCGACCCGACGTCGATTGTGCTGCCCGTGGTTACGGAGGCAGGCGACGCGACGACCAAGGAAGAGGAGAAGCAAGAACGCGACA
ACGGGGGCGACGACGAGGCCCCTTCCGCCAAGCGAGTGAAGACAGCGCGTGAGGATCAACAGGAGGGAGACGACCAGGATGGATCGGCTGACGGCGACTC
GGCGACCAACGAAGAGGTCTCGGTGGACGGCCACGAGGATGGGTCGGTCGAGGCTGAGGAGGAGGAGGATATGGGCGGTGCAGCAATGGACGTGGATGAG
ATCGGATCTGTCGAAGACACTGTCTCTGTGGATGAGACTGCGGTGGACGAGGACCTCGACGAAGAGGAAGTGGACGTGGACGGCCCCGGTTCACTGGACG
TTGCTAGTGACGAGACCCAACCAGCGACGCAGTCCCGCAAGCTGTCGGATGGAGGTGGCCTTTCCTTCGAAGAACTCAAGACGGTCAAGGGCATGCTCAA
GCACGTGGTCAGCCTCGCGTGGTCGTGTGATTCGAGTTTGGTGTTCGCGGGCTGCGAAGAAAAAAGCACCCGCCGCGGCCGGCTCTGCGTGTGGGACGCC
GAGTCAGCATGGCTACTGGCAACCTTTAGCTTTGACGGCGCTGTGAACGCGCTGAGTGCCCACCCAACGAATCCCGATCTCGTGGTCGTTTGCTCGTACA
GTGCACTGCCCGTGCTGCTCAACGTTCGCTCCAGAGAGATGATCGAGCTGGCTGTGCCCATTGTAAATTCCACGCTGACCGTGACCCCGCCGCCCAACAG
TCGCCACCCGTCACTGGTTGTAAATTGTCGGTACGGTATGTCCGGACACTTCCTTTATTGCGCGACGTCCAAGTCGACCGTGGCCATTCTCGACAGCATC
AGCCTCGCGTGCCTCGACGTGAAATACCTTTCGGTGCTTATCCAGTTTGTGGATCTCGCCGTGAATCCACAAGAGACAGCGCTGGCGTTCACAAGCTCCA
AGGGCATCCACGAGGTTGCCATCCAAGGTGTTGGTGACACCAAGCCGAGTCTTCAGGAGGTCCGGCTCCACGCCACAGGAGCGGTCCGCGCACCNNNNNN
NNNNNNNNNNTGGGCGCTGTGCTGCTTCAGCAGTGACGGCGGGTATGTCGTGGGCATGCCCATTGTGCGCCACCGCCACGTCGGCGAGAGCGGTCTCTAT
ACGTGGCATCGCGGGACGGGGCGCGTGCAGCACAACCTCGGTGTCAAGGATGGCGTGAACTCCATTAGCTGGGACGTGCGCCGCGACGCGATTCTCGTGG
TCTCGTGCGCCGGCGCGATCCATGTGCTGGAAGAAACATTCACGACTGAGTGGCCCGGGACGATGTATCCAGCCGGATTTCGTCTGGTCACGGACAATGA
AATGGATATGGAAGCGATTGAACGCGAGCTGGAAGAGGGGCAGGTCGACTCAACGAGCCAGGAGATGGCTGAGTCAAGATCATCAAACGGAGAACCCGAG
TTCGGTCGCGCAGTGGATGTCTTCTCTATGCGCAAAGATGAGGACGAATACGAGACTCTGTTGCCTTCAGTCGAGAACGAACGGCTCTACATCCCGTCTA
TCCCGATCCCGCAGAACGTCAAGCGCCATCACCAACACGACTTTCACATTGAGCGTCATTTTGGACTCGGCCAGAGCGTGTTTGAACCGCTCAA