Description :
From Genome Similarity Track
Location :
contig_140:14940- 17291
Transcript NameFunction/comments
g14266.t1hypothetical protein

Sequence
2351 bases(100 bases per row)
GTGATCCATAATCCACACCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATT
CCTTGTATTTCCAGCCGTCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATTTGCCCCAGTGTCGA
GCAGTATCCGCATTCGTGTGTCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTCACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTC
TCCAGGCAGCAATCTCACCGTCTTGGCGAGTCCTCGAGGTAACTTCTCCTCAGCCACTGCACTCGAGACCCAGGCTTCGCACTCACTCGACCCGCTTTCT
TCATCTTCACTCACATCGCCTCCACCGAGGTTTAAAACTCTCTCCTTCTTATTATCAGTCCATTTCACTCTCTCCGTCGTCATTATTCGGCCATTCGCAC
TTGCCCACATACGCGTAGATACAATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTA
GTTTAAATGCCCAAATACGAGGGTCTGGAGCTCGGGCGAGAGGTCTTCTTGTCAACCTTTGTTCTTGACGAGGTTGCGAGTTCTTGGAAAGCTTCGCACT
TGCCTGCATCATGCAGTTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGC
GTCGGTCTCGACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGC
AGCAGTTCGTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCA
GAAAAGTGTTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTG
TCAACGTGGCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCG
AGGATCGTCAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAG
CCACGATCTTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTC
CACACGTCTTTAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAA
GTAATCACAGATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAGTCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCA
TTGAGCAGCTGCCAGTCGCGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCACCACTCAT
TAGGCGGGGTATGCGTCCCTTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTCGCGGAGTCCGAGGTACGGCTTGATCTG
GAGGGGTCGATGCGTTGCAATCTCGAGTTTCGGTGTAGCATTCAAACTTTCCATATCGCTTGCTTCACGCATCTGACGCGCAAATTCAGCAGCTAAGTTG
TCACCATCCCCATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCCAGGACGTCGTCCGGGATCCTCGTTTC
GAGTTCCGCGTTGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGAAAGTACGGGG
AACGCTCGGCCGTCGTAGCGAATGCTCCACCCAGCTGTTGTTCACTTGCACCGGTGCCTCCATGCCGCTTGGGTGTTTGCGGTAATGGTATCATCGATGG
GTCGACAGTTTCCCCAGCTTTGCGCGCCACTGGTTGCCTTCCGGTACGATCGGTAGCCCCAAACGCAATACGGAGCTTCTTCTTCCATTTCTGCAATTCG
GCTCCAGCGGCTGATGGTGACCAGTCTTTCAGGATCACATCCGAAGGGTAC