Description :
From Genome Similarity Track
Location :
Scaffold_2395:1494- 2945
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2395-snap-gene-0.0Conserved gene of unknown function

Sequence
1451 bases(100 bases per row)
GTACATAGCAGGTTACCAGGTTACGTCCCAGTATTGGGATTAGCAGCTTTTCTGATCTTCCAGTTGAGCCCCTGGATGGCGCTTCCCAGCGCCAGAGGCT
TGGCTGGTTCAGGGAGCTCCGTCAACGGCGAGCTCTCTATGCCTTTGCATGTTGGCAGTTTACAACAATCAACCAAGAGCTCACTACATTGAATATCAGT
GGTGGCTTTGTGGGAGTTCCAGCTCCCAATCGTGTGTGCTCACTCTTGTCGTTGCGTGACACATCACACAAACGTGTCCTCTTTCAGGTTCAATTCGGGG
GCATCAGTCGGCTCGATCGGATCATCTTCGTAGTCAGAGCAACGCGCAGCGAGCATTTCCAACATACGATCCACATCAATGCCCAACTCGAGCAGCAGAG
GTCGGCCAACTAGGAACTCGTCGTCGTCGTTGTCTATGACCAAGCACGGCTTGCGTTCCTGGCACCGTACTGGCCCAGCCGCCGTGTGCAGAGTCAGATA
CAGATCCACAGCTGTGCTCGATGTGATGACCCCCCAACAGTGCGGCACACTACAGGCTCCGGGAGTTCGCGCACGGACACAGTCTGATCTTTCTGACTCA
GTGCGCGCATCTGTGCCCTTGAGATCACATTCCAATCCGACCCGCTGTCAGCACAGTACGGGATAGTGATGCAATCATTCACGCGAACCAACGCCACCGG
ATTCCCTGGTGCGTCGACTGGATGGTGATTTACTCGCTTTGACTTGCCCGATCTCTCCTTGGTTCTGCTACGGGCTCGATTTCTCAGCTGCTCAAGCAAA
CGCGCCTTCTCGTCGGCGCTCACAGTGCTGCAGTCTCTCACCATGTGAGGTCCACCACAGTGGAGACACGCTAGTGTTTTTGTACTCGCTTGAGGTGCTG
CACCTCGTTTGTCCTTCGCATTTACGACTCTGTTCGCGTCGTCCTCGCCGCGCTTGGGTTTCTTTATGCCTTGCGTCGAGCCTCGCGAAAACGCTCGCTT
CTTCTGCTCCGTCTTGCTTCTCATCTTGTTAAAATGAATTTCTTGAGCAAGCGCCTTCTCCACCACGACTCGATAGAGGTTCACTTCATTTGCGCGCGTG
TCTTCGTTCTCGAATCGCTGATACTCCAAAACGTCGTCTCGCAATTCTGTCGGCTCGAGGTGCCGCACAAGCAGCGTGCACTTCTCTCGTTTACCTGCTT
CGCTCGCGAACTGCGTCGTCAGTCCATTCTGCATGATCAGGTCATCGGAGTCCTTAAAATACGTGACTACCCGCGCGATGACGTCACTCTCACGCAGGTT
CATTTTCAGTTTCTCGCCAAACAGCCTGTTGATGTTCGGCACTTCGTTGTTCTTCACACTGCCGATGATCGTATCGATCTCGAGCACGATCCGTGCGTCA
TTTATTGCGCCCGGAGTGGTGTTCCACAGCAACTTGCAGCACGTGGCGAGC