Description :
From Genome Similarity Track
Location :
Scaffold_582:14936- 17922
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_582-snap-gene-0.15Mot1

Sequence
2986 bases(100 bases per row)
GATCAAGCAGCGATGCTGGGAGGAGACCAAGCCGCTGTCATCTTCTGCTGACGTTGCTGACTGAACCCCAATATTGCAGGACTCGACCAACAGATCGTGC
AGCGCGATCATTTTTCCCGAGCTACTCCAGTCCGCCGCTGCTTTCTTGTCCTTTGTACTCAGCTGCTGCATGAGAGCGCTCTCGTGCGCGACCAGCGATG
GATGCACGCAGATCTTGCGCAGCAAATGGAGATTCGTGAGCACACTCGCCTTCTTCTCGTCTATATCCCTCTCTTCCATCTTCCCACCTGTAGAACTTAT
TGCCAGCCCATACAACTTCTTCTGGACTGCACTCATGGACGCCAGCACGTTCGAGATGATCTTGGGCGGCAGCTCCTTCAACACCTGGCCCTTGGTGCGG
CGCAGAATGAACGGGAGCACGCGCTGGTGCAGACGCATGATCGCCAGTGCTGCTGTTTCTTTCTGTTTCGGGGTCGCATTGCGCGCTCGCGACTTGGAGA
TCGGCAGCACGTACTCTCGGCGGAAAGTCGCGAACTCGCCGAGGTACCCGGGCATGAGGAACTCGAAGAGCGACCACAAGTCTGCAACGTTGTTCTGCAG
TGGAGTGCCGCTCAGTGCGACTCGACGGGACGCAGTGAGCTGCTGGACCGCACTGAACAGCGAGGTCGTCGGGTTCCGGATCAAATGCGCCTCGTCCAGC
ACCACGAACTCGTATTCTTTGCTCTTGAGGAAGTCGATGTCGGTTCGCAGCACCGCGTATGTTGTCACAATGAGCGTTGCACCCGGAGACAAAGCAGATG
ACAACAGTGAACCAAAAAGCCCCTGACGGACAGTCTTCCTATCACCCGACGACCCCGAGTAGTCAACGATCGTCTCAAAGACACTAGGAAGACGCTTTTT
TGCTTCTGTTATCCAGTGGTGCGTCACAACAGGTGGACACACGACCAAGCAAAATGAGCTCTTGGCTTCAGAGTCGGCTTGCTGACGACGACTCAGTGAC
GCACCAATACCCGCGAGAATCTGCAGAGTCTTCCCCAGTCCCATGTCATCAGCCAGAACCCCGTGCAGATTGTTCTCGACCAGGAACGACAGCCAGTCCA
CTCCGTGCTGTTGGTACGAGCGCAGCGCGACACCGTCTGCAAGGAAAGCTTTGACGTCCACGTGCTTAACGGCTTTTCCTTCCAGCAAATTCTCGAGAAA
CTCGCGGGAGACCTGATTCTGCCCAACAATGTCTCGTAGTGAGCCTGGTACTAGGTCGTCACCATCTCCATCGTCACGCTGCTGCGGCGGCGGCTTCTCA
CGACTTTGTGACACAGAGGCGACCTGTAGATCCATTTGCAGAGGCACCAGCGGCACAAGATCTGCGAATGCGCGCGCAGCTAGAGACCGGATTTCCGCGT
TTTGTGAGCTCATCGTCTTCATCGAGAAATGCACGAGGCTCGGAATGTACGGGGTCAGCTCGGTGGACAAAGCGTTCACGAGGTGGTGGAGCACCAGTGT
TGCGCCGACGAGCGAGTCTCCGGATCGTTCGCTTTGTGCGCTTCCTCCGTCACTAAAAACGGAGAATATGTGCTGGTAGACAAGCAGCATGGCGCTTTCC
TGGTGATTTTTTGCGTGGCGACAAACGCTCGCGATTGCGAAGGCGACCGCTGTGCGAGTGTGGATGAGTCGAAACGGCTGCGTGGCCAGAGTCGCTAGTC
CTTTCAGCCACTCGAGGCACTTGGGAAACGCTTGCGAATGGACACTTGGCGCTAGAACACACACCAAGTGACTGCTCTGATGGACGATTTGGTCCCCCTG
TTGAGCACCTGTCCAACTCTTAGAGACAATGCCATCCAACGACGGACAAATTGAAAAGATCCGCTCACCAGCGACTTCGCAAATTACCTTCAGAGCATTT
TCCGCGCCTTCAACGCGAACTCTCATTTTCCGAAGCACCTCTGGCGGCAGAGATTGGCTACCGGCCGAGCTCTGAGGTGACGGATCTCTTTTTGGTTCTT
TCACAGTTTGCCCACTTGTTTCGTGTGAATTCTCCGAAAACGCCAGCGCCACTGCACTGTTACAGAGATTCGAGACGATCTTCGCGACGCATTTCCGCTG
GACACTCGCTTGCGAGACGACGAAATCCGCCATGGTCTGTGCAGAGAGCTTCTGGAAGTCGGCATTCTCTTCCTGTTTGGCCGAATCCATCAGCGCCTTC
ACGAGGAACCCGCTCTTCTTTGGTGGGATCGCCAGCAAGTTGGTGAACGCGCAACTCCCGAGTCCCTGGACACGGTGGTAGAACCGCGCAAAGCTCTGCT
GGAGCATCTCGTCGACGAGGAACAGATCCTGACGTTTAAAGTGCGCGAGCTCAAACGCCTGTGGGTGAGCCGCCAGGTTGCTGTACGGAAACGAAGCGAC
GTTCTCCGCAATCTGGCGGGAAACATCGGCAGCCGAATGACTTGCTGTTGCTGTTGTAGTAGTAGGAAGACAAGAAGTGACGCCGTTTGCAGTGAAAATC
TCAATAATCCTCGCCTCCATGACCCGAATCCGCTTCAGCTGACCACACTGCTCCGAGTAAAACGCGTGTTCAGCTGACGATGATGTCGATTCTTCCTTTT
TCAACTGAACGACCCAGTCTCGTTGTGCAAGCGACTCGAGTGCGGGTCCGAGTGCTCGCTGCAGGGTCTCCAGTCGGTTGGACACTTCACCACCACCATC
ACCAGATTCACCACATTCTCTCGCCTTCTGCAGATTCTTCTTCTCGTAGTACGCCCATCGAGCGATCGTCAACAGAGCACCGCACTGGCGTTCTCCAGAC
GCAGATTGCAGGCTTCTATTGAGCTTTTGGATGAGTCCATCGCTTGCGGACGTGTTGAACGACACATGAGCTCCCAAATACCCAATCGCGTCAGCAAAAG
CCACGCGCGAAGCAGAGTTCACTTCCGTATCTGTCGACACTGCTGCATCACCAGCACCAGCACTCTGAAGACAATCACTCTTCTTA