Description :
From Genome Similarity Track
Location :
Scaffold_398:14935- 16588
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_398-fgenesh-gene-0.8Ran-binding protein (RanBP10)

Sequence
1653 bases(100 bases per row)
TGCTCGCGCATATTCGCAGAGCTTCTCTCGCCGTACCTGTTTGGAAAAACTGACTGAAACAATCCGCAGCATATGCGCCAGCGCCACACAGGAGCTCTTC
ACCACCCGATCGACACCAATCATCAACGGTCCCTGTGAGGGACCGGTTCACCTGAACCGTTCTGACTAACTCGAACCCAGTCACAATACGTTGATCAGAT
ACGGTACATCACGTAAATACCATGTTTTTCAGTCTTGCAACCGTAAGTATGAAGATTTTATTAGCACCGTGTCTACTCGAATAGTGGCTCTATAGTGATG
CTGTTTTGGGTCGGTAGGAGCCATATTGGCATAACACATTGCTATAATGGCGTTGCTGCATGCGCACTTAACGAGTCTGCCGGACGATCTACTCGCGCGC
ATACTCGCGTTCACGNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGTCGAGGCCATGGCGGTGGCCAGTAAGACCGTCACGCGCCACGTGCTGCCGCGGT
TCCCACTCTGGAAGACCATGTTTTGCAATCGCTGGGCGATGTTGAACTTTTCGCTCGACAACACCATCGACGTTGAAATTGACGCACGGCTGCGCGCGCT
CTTTCCCAGGTGTGTGCGTGGCTGTCTGTGTATAGCACTTGCTTCGTTTCGTAAATGCTACTAATGATGTGGTGTGTATATATCGTTGTTGCACATATGA
CAGCTCCTGTAATGAAAGCCGCATGTACCAATTGCTGACGCATGCCGTCACGCCCGTGCCGTCCTATGCCGATATCCCAGCAACCATGCAGTATGGACGA
GGAATCAACAACACGTGCGTGCACTTGAATGGGGACGACGTAATGCTCATGGAGGCGAGAAGACTCACGCATGCCGTTTGTTTTGTACCTCCTGCTCTTT
CTGCTGTTTGTGAATGTGTCAATTCAGCATCGTGGCTCTTAATAGCGATTTAAGCGTGCGCGCCGTGAAGTCCCGCCGTGGTCGTGGAGCGCGAACTTTG
GATATAGCATTTGCAGGCCAATTGCTTGGTGGAGACCGCAGCGTGCGCGCCAATACGGCATTCCCCACGACGTTCCATGTGCAAGTGTACAAGCGGAGAG
TCCCACACACAGATTCCAAGTTCAAATACGAGATCGGCGTCACCGCCAGCGGGTATTTTGAGATCACGATCGCGCGACGTGAGCAAGAGCAGACGTCACG
ACGCCACCTGCGCATTGGGGGCAGCGATATGTCGTCCATCGGCGTCGGGACGCCCCGTTTTCGCCTCGTGGACAAGCAACCCGGATGGGATCGGCAATCG
TTTGGATACCACGGTGACGATGGACGATTTTACCACAACACGGGATACGTGAGTATAGAGTGTCTCTGCAAGCTATGATGCAATTATGCGTAGTAATCAA
ACCTTTGACAACTGTTGTGATGCTTTCCAGGGTCAACACTTTGGTCCGTCGTTTGATATCGGCGACACAGTCGGCTGCGGCGTGTGGCGCGATACGCAAA
CTTCTCACTCGTCGGTGTTTTTTACGAACAATGGAGACCTAATCCCAAGTACGTGTGCTGTTTTGCGCGGCAGCTAGAGTCATGAGGTTGTTGGCGGCTT
TTTTTTGACGTGACGCATGCAACTTTATGTTTTTTTTCTGAGATAGCTGGAGA