Description :
From Genome Similarity Track
Location :
Scaffold_359:14932- 29377
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_359-fgenesh-gene-0.8HECT E3 ubiquitin ligase
Pytir_DAOMBR486maker-pir_contig_359-fgenesh-gene-0.4C2 domain-containing protein
Pytir_DAOMBR486maker-pir_contig_359-fgenesh-gene-0.5Flagellar associated protein
Pytir_DAOMBR486maker-pir_contig_359-snap-gene-0.17Vertebrate sel-1 suppressor of lin-12-like (C. elegans)
Pytir_DAOMBR486maker-pir_contig_359-snap-gene-0.20Serine/threonine protein kinase

Sequence
14445 bases(100 bases per row)
CCTCGCCGTTCTCCAGCACCGTGTTCTCCAGCTGGTCGCGTCGCAGCAGTCCGTCGAGCAGTGTCGCCTGGTCCGTGTTCTCGTCGTCGTTGGGCCAGCA
GCAGCAGTAGAAGATCGCGGCGACGCCGACCAGGAGCGCCGTACCGAGCGCCACTGCGAGCCATGTGATGGCCGTCATGAGGCTGTCGGAGTCGGACATC
TTCGCTCACACCTCGCTTCTTTCGTATTAAGCAAGCAGGTCTGGGCCACACGTACTACAGTGTAATACAGCGATAGAGAGAGAGAACGAGCAAGAGAGAC
GCGCTTGCTAGCGATTACGCCCGTCGTCAAGAGCGCAACAGCAATTTTATCTGCGAGACGAATGAATGCGTGAGACGACTGTGTGGAAGTATTCAGCATT
CAGCCCAAAAAGCGCGATCACCATTTAACTCGTGTTTTAACAGCGTTTAATTGTTTGGAAGACGAGATGAAGTAATTTTGAAAGGGTATTAATTTGTTCA
GGTGATATATTTGTTGTTTGCCTGTTTTTGAACAAGATTAAAATAGTTTTTGAATCGGTTGGAGGTACTTGGATTTTCAGCGGATTATGAAATTATGAGG
GTATAAAATTGTACATGTTACTGAAATAAAAAGGTTCGCGCTCATTTTGTTTTGCAGCGAATGACGCTGGAGGATCACGCGTTACGTTCGGTTTCGGATT
GTGTGGAGTGACAAATGCGCACGTAACAAGCATCGAGGTCCATTAAGTGTGCATACTTTCCCCCAAGCCTTTGTTTTCCTCCTCCTCACCGTCACTAAGG
CCACCGCCGAACGACTTTGAGATTGCCAATGACCTCCCATTTTTGAATTCACTCTGTCCCCTTGACGGCCTCCAACGCTTTGGAGATCTTGCCCTGCAAC
AAAAGCAGGGCTACCATCGGAATCGGCACACACTCGAATGCGGTTGCTTTTGCAGAACACCGCGACTGTACTGTGTGTTGGTTGACCCCAATAGCCTGTA
TTGAGATGGATCAACACTGCTAACATCAGCCTCTTCATTTGCTCGCGGGACTGGAGCTTCAGTTGGACATGATCCTAACCGATTCAAGTCCAAGCGACCA
ACGCTCCTTTCGAAGGCAGTTAGGCATCGAATATTCGCGAAGCAAGCAGTCACAAGATTCGGCACAAGACGCGCTCCGCTATTGTACCAGATTCAGATCT
AAGACGCCAAGGTGCTTTCTTCTCCATCATCCATGTGCGCTGTTCTCTTTGATTGCTTTCAAAACAGAAAACCGGAGATTGATTTCCACCAAGCAAGCTC
ACCTGGGTTAATAATGAACATAGCACACCCTGTCCCCTCTCAAAGTCGATAATACAAATAAATGTAGCCAAGAGATTGATCTTGACTGGATTTCCCCTGC
CTTTATCGACATTAAACTGTCTCACGCCATGTCTCAAAACAGTCTCCACGCCTGTCAATCCCTCACAAAACGGTCAATGCACCCACGCGTCACTACTCCC
AAGAGTCACTGTCTACTGTCGCTGTTGTGGTGCCTCCAATAGCGGCGTCAGCCACGCAAGGACGGAAGTTACTGATCAGGCAGCACACTCACTCTTCGGT
GGCGCAATGGCAGACATTTCGACTCTTGCCGTGCCGGCCCCAAGCAAGCAAGCCCATCCCTCTCTATATCAGCAGCAGCACCAAGAGCTCCCTCTCTACA
CAGACAGATAAATAGCCAGCAGCATGGCCGTGCTCTTCCTCACGCTGCACAGGGCGTCGGACCTGGCGGCGAGCGACTTCAGCTTCAGCGGCGGCAAGAG
CGACCCGTACGTGACCGTGGACATTGAGCGCCAGCAGCGCAAGAGCGCAATCGTGAAGAACAACCTCAACCCCGTGTGGTCGCCTGGCGAGCGGTTCCAC
TTTGACATCGAGGACGTGAACCGCGCGATCGTGAGCGTCAAGGTGTTCGACTACGACGCGCTCAACAAGGACGACCTGCTCGGCGCGCTCGTGCTGCCGN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTCGCCAACATGATGGGCCAGTCGTTCACCGAGGTGTTCAACCTCGACGTGCCGGGCGAGTTTGCGAAGCAGAA
CCGAAGGAGTACGATCGAGCTGGAGATCTGCCTGAAGGCGCACGACGACGGCGAGAAGACGCTGGCGATGTGGGAGAACGAGACGTGGGCGCTCGGCAAG
GGCTGGACCGCGTGCGACACGAAAGAGCGACAGCAGTGGAGCTCTGAGGACGAATCTAAGTCGTCGGCGCACTTTGGCGACATCGCGCCGCCTGTGCCCG
AGGGTCTAGCAGGCGGCGGCTGGGAGTACTGCGCAAAGAAAGGAGACACGCACGGCTGGGTGTACGCAACGTCGTTCAGCGGGCCGTGGTCTGCGACAAA
GAGCCGCCTGCACTTTGTGCGCCGTCGCCTGTGGGAGAACCACTGCACACCTGTCACAAAAGGACCGGATATGCAGGGTCACGTCATGTTTTAATAGCGA
ACAATCCAGAGGCAGAGAAGAAGACTAAGAGCGAGCGAGCGAGCGAACGAGTGAACGAATGAACGAGACGAATGAATCCAGCGCGGCACGAACGAGAAAG
AGAGAGAGAGATAGAGAGAGAGAGGAAACCCCAACTTCAACCCACATTTGCTCAGCATTTGTGAAGCGACAGCAGGGGTTCGATCGTGGAGTCAAGCGCG
CGTATGAGATAGATACCTTGCCCTCCAGCTCATCAGACGATCCATCCAAGGCGCAAGAAGCCACACGCGCGCTGCCATATTCTTTTTTGTTGTTGCGTAA
ATATATCATCATTGCCATGCCTGCATGTTGGATTGCATACATCAGGGCAGTTTTGTATCACGCACCGAACACAGGAAGAAAAGCACGCGCACGAAACATG
AGTTGCGTCACCTTCGAGTCACCTTCGGATAACATCCCAAATGAACATGGTGACGTAACCCTGGTCCACCCATCCTCCTCACAACCTCACCATCTGATAA
TGGATACTTTTTTGGCTCCAAGGTTCGCTTTGCATGATTGCACGGCGCTTCGCTCGCCATTGCCATATTCTCACAAGTGATCGAGAGCAGCACGCAACCC
AGAGCCTCACACTCACACTCACATCTAGACGGATACGGATAGGAATGGCGACAGCTCCACAGTACACCCACGCCGTGAAAGTGACGCTCTCGCACGCGAA
GGAGCTCGAGGCGGGTGACTACAACGGCTACAGCGACCCGTACGTGATCTTCTCGCTGGACGACGGCCAGAGTGCGCGCAGCTCATGTCGTGCGCAGACA
GTGGACCCCGTGTGGAGCCCGCCGGAGCACTTTGACTTCAAGGTTCTCGACCCGGAGCAGCGACATTTGAAGGTCGAGGTCTTCGATCACGACCTCGTCA
CGAGCGATGACCTGCTCGGCTTCGTCAGTATCCCGCTCAAGGACTTCATCGCAACTGACGACACGAGCAAGGCGACGCCGATCGCAGTGACAGCCCCCAT
AGGCTTCACGCTGGACGCACCCGAATCTGTCAAGCCTGGGGCCGCGAGCCAGGTGTTCCTGCGCATTACCGTCTTGCCCTTGGACCTCGCGGAGGTGGGA
CTGGAGCTCTGGGAGAACCAGTACTGGGTAATCGGCACCGGCTGGAGCTCGAACAAGAAGTACTTCGTGTCGCACCGCCACCAGTGGAGCACGAAGGATG
GCGAGACCTCGTCGAACGACTTCAAGGAGATCGCCCCCAGACCGCCTCTGGGGTACCAGAGCTCTGGCTGGACCTTCTGCGTCGGCAAGGGGGACACCGA
GGGCTGGCTCTACGCGACCACGTTCGCGGGGCCGTGGTACCCAGAGAAGGGCTCGACGACGTGCGTGCGGCGCCGTCGATGGGAGAACATCTGCCGCAAG
CCCAGCTCGTCCAAGTCTCTACGAACATTATTTTGAGCTTGTTCATGTACCAAAATATGTCAATACAACCGCAGCTCTGAGCGCTGATATTGATAATACG
TGCAATTCCTCATATATATAGACGATGATTTGTCCAAACCCCAAAACGGTCCAAGTTTGATTCGAGCCCTGCGCTCCCTCGACGCTTCATAGAATCCCTT
CTATTAGGACTAACACGCCAACAGCAGCGCCGACATGGAGGTAGCCCCAATTCATAGCGATCAGCATGCGGACGCTGTAGTCTCAGGATCAGCCTTACCA
GCACCAACACCTCCAGTAACCAATGGACCGGTCCCGTCCAACCCAAATGCACTTCGCCTCGCGTGGACCTTTGGCTTCAACAAGGACCTCGTAAACGGTG
TGCACAACCTCTCGAGCGACTCGCGGCGCGCGTTCTTCTACACGTCAGCGCACACGGGCGTGATCTATGACTACGCCAAGCGACAGCAGAAGCTGCTCCA
GGGCCACTGCCACCCGATCAGCTGCTGCGTCGTAAGCGAGGACAAGCGTTGGATCGTCACGGCTGACAAAGGCGACGAGTCCATGATCGTGGTCTGGGAC
TCGGCGAGCGGCAACCCGATCAAGACAATCTTCCAGCCGCATGAGCGTGGCGTCCAAGCGATCGACATCTCGCCCGATGCGCTGTTTCTCGTCACACTTA
GCGCCGTCGATGGGGCTCCAGGGTTGTCAGCCACAGTATCACATAGCGTGTCGGCCCGCAAGCACCCGCGGTTCCACCAGGAGCTTTCGGTCTGGGAGTG
GACGTCGGCCACGAACTCGTCCTCGGCGCTCTACTCGTCGTTCGTGGCCACGGAGGACGTGCAGCACGTCGTACGCTTCAACACGTACGACATCCGCGAG
ATCGTGACGAACGGCAGGCAGCGCGTGATCTTCTGGAACTGGCAGGAGCAGCGGCTGCTCTTCTACTCGCCGTCGCTCTCGCAGCAGGACTTCCGCCAGG
TCGTCGGCAACTTTACCATGTCGCTCTTCGTGCCGGATTCCAAGCAGGCGCTCACGGGCACCGAGGACGGCGACCTCGTGCTCTGGGACGCGGTGCATGG
CGACGAAGAGGACGACCTCAACTCGTCCACGATGCTACACGCCACCGGCGCTAGTCCAGGTATCAGAGGTGGGGGCAATCGCTTCCCCGACCGGAAAGCA
GTCAAGATCGTGCGGCTCACAGGCGGCTCGGAGCTGCAAAAGAAAGTGTCGCTGAGCTTCATATCCGATATGGACGGGTACCTGATCCTGGGCTCAAGCG
ACGGCGCCGTGCGCTTCTACGACTTTGACTTCCGGCTCGTCGCCTGGTTTGAAGACATGAACGCTGGTCCTGTGACCTCTGTCTCATTCGCCGCTGCCAG
TAGTGCCAATGGTACTGAGGATCCGTCCTCAGCTATAGCTCAGGGTCGACGAACAAACGCGATGGGGAAGAGCAGCCTCGACGACAATGGAGGCGGCGAG
GACGAGTTCTTCCAGGTGCCGGACTTCATCGTGGGCACGTCGTCGGCGTTCATCGTCGGCATGAGCGCGACGCTGTTCGCTGAGTACGAGTCGGAGAAGC
GGCGCGGCACGCTACTCATGCAGGGTATCAACGACGCGATCCACGGCCTCGCCGCGCACCCGCTGTACGCGCAATTGGCGCTGAGCTCCTACTCGGGGGT
CATCCAGCTCTGGGACTACGTGTCCAAGCGGCTGATTATGATGCGCAAGTTCGAGACCGACAAGCTGCGTCCACAGTGCCTCGCGTTCTCGCCCGACGGC
AAGAAACTCTTCGTGGGCTTCACGAGCGGCGTGATCAAGATCCTGCACGCCCAGAAGCTCGAAGACCTCGCGGTGTTCCGACTCTCCAAGGTCGCAATCA
CGGACATTCGTATCAGTCAGGATTCGGCGCTGTTTGTCGCGGTCGACGCGAACCTGTACATGGGTATGTGGCGCTCCAAGGGCAATGGCCTCGGCGGCGG
GGACAACGACGACGACTGGGCGTACATCGGTCGCTGTCGCGCGCACTCCAAGCCAATCACGGGGCTCGAGTTTTCGCGCGCGAGCGACGGCTCGCCGCTG
CTCGTGTCCGTGAGCGAGGACAAGACCATGGTCGAATACTGCCTTAGTCGCTCGAGTATCGTCGACGGCATCGTGCTCGCGCAGCCGCCCGTGCGCATTG
AGCAGGGGGCGACTCCCACCGCGTGCTGCTGGCACCCGGAGCTCAAGTCGCTCCAGGAGGACCTGCTGCTCGTGGCCAACGACGAGTACAAGGTCAAGCA
GTGGAACACGAGCAACAAGACGTGCCGCAAGACCGCGCTTGGCCCTTCGTACGGCGGCCCGATCAACCGGCTCGTGCCAATCCTCGTCAAAAAACAGCCT
ACAAGTTCTGGGACAGCGAGTTCGATGATGACCTCGGAGCGCTATTGTGCCTACAGCACGCATGAGAAGGTCGTGGGGCTGCTCAAGCTTCCGCTGGACG
GCAATCCGCACAAGACCATGGGGCTCATCGCGCACCCGGGCGAGATCAGCAACATCGACGTGTCTGCCGACGGCTCGTGGCTCATGACCGCCGGCGGCTC
TGACATGGTCGTCAACATGTGGGAGATCGACACGAACCAGCTCGACTTTGCCGAGGCCTCGGGCGGCTCTAGTGCTAACCATGGAGATGAAGGTGACGAT
GACAACCTGGGGCCGTACATCTCGCTACTTGAGGGCGGCAAGGACGGCGAGTTCTACCACGAGATCGTGGACTATTTCTACCTGGCGCAGCTGCGCGTCC
AAGGTGAGAACGCGACGTCGAGCCGCGAGATCACGTCGCAGATCCCGCTGCGCGAGATCCCGAACGTCATGCGCGCGCTTGGGTTCTACCCGACGGACCT
GGAGATCCAGTACATGTGCAGCGAGGTCAAGTACTCGCGGTTCACGGAGACCACGCAGACGGTCGAGAGCATCGACCTCAAGGACTTCATCAAGCTCTAC
GTGAACCACCGGCCGGTGTTCGGCATTGGCAAGGCGCAGATCAAGCAGGCGTTCAGGGCCCTAGGCGGTGGCTCGAACCCAGCGCTGCGGTGGGATACCC
TGGAGAAGCACCTGCTGCACATGGGCGAAGCCATGAGCGAGGATGAGCTGCGTAGCTGCCTCAGCGCGCTGATTATTGCAGACGATGGCGGCAGCGTTGC
GATGGATTCACACTACACGGCGCTCAGCTTTGCCGACAAAGTGCTGGGCTTCGACGACTACGAGGCAGACGTGCCAGAGGGAGAGTAAGCATCTTGAATG
GAGGGAATAGAAGACGGATATATATATACAAACGCTCAGGTGTTCTATTGATTGATTGAGGTTGCAAATTGATAATTATGTCTCGAGGTGCTGGTCTCTA
CGTCATGATCTGGTAGTTGCCATAGTCAGAGACCTCGTCGTCGGTCTGGAAGTACATATCATTCTCGTCGTCGTCGCCCTCATTATCTTCCAAGTCCTTC
TCCGGCGAGAGCGTCGCGCGATCCCTCAGATCGTCAAACCAGGATGACCGCTGGTGGGCTTGCTTGGTCCAGCCGAGCTCCATCGGGTTCTCCTTCACCG
CCTGATCTATCGTCTCGTTGAGCACGAACTCGGAGAGCTTCTCGCTCAGTCTTTTGAATAAAAGCGAGCTCTTCGTTGGCTTCACTGGAGCTGGCGCTGT
AGACACGGACGCACGTGGTTCTTCACTCTGCGCGTCTTCATGAATGATTTGCTGTTGCTGTTGTTGCTCTTTGATGAGTTCCTGTTCTTGCTGGTGCCGA
GCAGACTCGAGTTGCTGGTGCTGCTCCTGGATCTGGAAGTTGAACGCGTCCACCAGTTTGCCGAGAAACTGGTCCAGCGTATCCTTCGCAGTGGCCTCGC
GGCGCGAGATCTCGCCGTCGAGTAAAGAGCGTCGCTCGCTTCCAGGCATTTCCAATCGGCCACCTGAGTGGTGGTGTGTTTGTTTGGTTGAGGTACTGAA
GACGCAGATGGGCTCTTCAGTTCGGTTCTGCTTTCCGATGGGAGATCGAAAAGTGAGAGAGAACACTGTGTTAGTGCCAGCGCAATGACAGAGACCTTCT
TTATCATAGGAGATTGTAGCTCTTGGAGGATGCTGATGGCAGAGAGAGACAAAGCCATGTGTGGTTGGAGAGCCCAACGGCTGGCTGAACAAGAGGAAGA
CCAGGCCAGGTGGCTGGCTGGCTGGCTGGAACAGAGAAACGACGAGGCAGATGGAAAACGGAGACGCATTGCTTACACACGTACACACATGCCACAGTAC
GTTATTGTATTGCTTTTGGCTGTGTGAGAACTTGTGAACTTGTACTACGTACAACATTACGTATGAGAGGCAATTGATTGATGAGGCAAATGGGTGGTCG
CAGGTGCAAGTGTGAAGCCATATTCACAATGACGTCAGCGGTTAGTTGCTCGCGCCGTTTCAAGGTGCTGTTGCAATAGAAAAAAGACATATTTCTCAAA
GACCGACATGTTGAGTTCTTCAAGCCATGCAATGGAAATGAACTCGTAGCGCCGCTATCCTTCATAGCGTCTGCGTCCCAACAGCAGTGCGTCAATGGAT
TGTGGTCGTCTCTATCTATCCACTCTGATGAAGTCGATGTCGATCTTGGTGGGCAAATCAAATCAATCCCATCCCACACTCGCAAACCACCTGGCTGCTC
GCTCTCTCATTTGACGCCAGCTGGAGCAGCTCAACGCAACACACAAAACAACACAACGCCCCGATCCTGACTCTCTCTCTCTCTCTCTTGTCACCAAATA
GAAATCAAACCCCATCCAGCAGGCTTGTTGTTCTTGTTCTTGTTTTTGGATGTCACTCCATACCTTTCGCTGTCCTTTCTCGGATTGATTGAAGAGAAAG
ATAGATGGCCGAGCGTCAAGGAGCTCATTCCAAGTTTTGGGACGTTGTGATCACGTGCGACTGGCTGACTGCTTGCTGCTCAAATAGCAGCAGTTGAAAT
CAGTGAAGTGGCGAGAAATGCGGCGCAGTCGCTATGGGCAAGTAGTGGTGCTAGCGCTTGTGGTCGTGTGCCTCGCACTGGCCATGAGAGTCGACGCGCG
CCAGTGCAAGTACGGTCTTCTCGAGCAGCTCCTCGCCAATGTGTCAAGGTATTATGCATGAGCGCTTGCATCTCAACCTACCACTACTATTTACTATATA
GCCCGCCTTTCTTAACCAGCGATTTCGGCAATGCTCACTGTAAAATTAGCTCGCAAGGTGTCGAGGTCTCTTCAAGCCGCCATGCTGCTCTCCTGAATGA
CCCAGCAGCGATCACCGCAACCGCGTTCTTCCAAAAGCTCCAGAGTCAGCAGAAGGGTCAGCTGCTGCTTCAAGCTGCTCGCCTACAGCTCTATGGCGAT
GGCCCGACCTCGCCCAACATATCAGCAGCAAAACGGTTGCTCCACGTAAGCGCCGGCGAGTTCGGGAACCCTGACGCTCAGTTCTTGCTTGGCGCTCTCG
CGACTTTAGAGGATGACACACCGGCTCAAAGCGTTCTCTACCAGTACTTCGGCGCTCGCGGCGGCTCCGTGGCAGCGTCCATGGTGCTCGGGTACCGTCA
TTTGTACGGTTACCAAGTACCCAAGAGCTGCGAAGCTTCGCTGCGGTACTACAAATTTGCAGCGGACCGCGTGATCAGCTTGCAGAGTTCGGAACGCCCT
ATCCAGGTGTTCTCCAGCCCCGAGCCGTTCCGGTTGACTGACGACGCCAGCAAGAAGAAGCCCGGACGTGATGACGAAGATGCACATCGCGTGGAATACC
TGAGGCAGAAGGCACTGAGTTCTTCTGATCCGGTTCTACTGGAGAAAGCCGCGAGCGTCGTGCTTTTCAGCGATCTCCCACACATCGCCACTGCAAGCAG
CACATCTCACAATGCTGAACCAGAATACGCACGGACTCTAGAGGCCAAGGCACTGCTCGACCGTGCTGTCAACCTTGGGAGCTTCTCGGCGAAGGCGCTC
TTAGGACACGTCTACGCCTACGGACTCGGCGGCTTCCATCCGAATGTTCCCAAGGCCATTCGGCTCTACGAGGAAGCGCTGAATGAGTCGACGATCGCGA
ATCAGACCAGCGCAGAGGCGGCGAATGGACTCGGGCTCATCTATTTCAACGGCGTGGGCGACACGCACATCGACTATGAGCGTGCGATGCGGCTCTTCCA
GGTATCAGCGCGCTTGGGCCATGCCGACGGGGTCTACAACACTGGCGTGCTGCTCTCCAAGTCCCATCCGCAACGTGCACAAGAGTACCTAGAAGCCTCG
GCGCACGTGGGCCACTTGAAAGCGCAGTTCAAGCTCGCGAGGCTCAAGGAGAAAGAGCGCTTTAATGGTATCAAGCAGAGCCGGAAACAAGCGGCAGATT
CAAGTCATGTTGGGTCCTGTGAAGAGATCGTCAAGCTCTACAAACAGGTCGCTGAGAACGCTCATGAGGGCAAAGAGCTCCTGGAGAGCGCAGCGGCGGT
TTTCCTGTTCGCAAATGATCGGGATCACGCGCTAAAATTGTACCTGCTGGCTGCTGAGATGGGCTATGAGGTCGCCGCGAGCAACGCCGCGTGGCTCCTC
GAGCGCCAGGGTAAACTGTCATCTAGTGACAGCAAGTTGTACCAGGAACTGGTTCGTCGCGGCTTGGCTCAGGACAGCCCCGATGCCCACGTGCGGTATG
GAGATCTGCTCTATGAAGAGCGCAATTTTGCGCTGGCAATGTTCCAGTATGAGCTCGCAGACTACCTGAGTCACGGGAAACACGGTCGCGCACTGTTCAA
CATGGCGTTCATGCACGAAAAGGGACTCGGCGTGGCCTCCAAGTCGTTGGAGACTGCGAGCATGTACTACGAACTGGTCGCGAGAGTAAAGCCAGCGATG
CTGGAGGTCGTGTGGCTCATTCGACTCAAGCTCAAGGTGCAAATTCATATCGAGAGACTCGCAGAGAAGATGTGGAGTATGCAGAACCAGATCTGTGACG
TCCTGGGGCTCCTGAGTCTCAGGTACCAAGAGAAGCATGGTGCGACGGATGCTGAAGATACAACCAAAGGCAAGCCAGCCAACGCTTCATCGACAGGATT
CGCTGATGAGTCGTACCAAGTTGACTTGGCTCTACCACTAGCTTCAGAATCTCAAGACCGCGACGTCCAGGACGGGGTCACATTTGCCTCGGCAATGCGG
TTCAAAGCCGAGTCCAAGCTGCAGCTTGAAATCCTCAGGTCCTTACGACAGCAATTTACGGTTGATTTTTGGATCAAGATCCAGAGTTCTGACCATGAAG
ACAGCAGCAGGAGAACATACATGGTGTTGCTTGACGTGCAGGACTCATTCCAACTAGAGCTCATGCGCAGCGACAGCGAGAAGAACGAGTGGGTGGTGCA
GTTCCGCACCATGTCGACGTTGTTTGTGTTTCCGAACGGGAAGTTGTGTGACGACAAGTGGAGTCACGTCACACTCGTTGTCGGCGCTGCTCGTGGAGAC
TCCTCTGACGATTCCGGCCCAACAATCGCGCTCTTTATGAATGGAGAGCTCCGACACCAACATGAGTATCAGAGCCATCTCCACCATGAGCCCTACAGCA
GTGGTGGTGTCACACAGAGGATCCTCTCAATTGGGAGCAGTCTGACGCGCTCAGCGTCCCCAGCGCAGTCCTCCCAGTTCATCGGCAGTCTCATGAATTT
TCGGATATGGAGAACAATGGAGACTGGACCTTCGATTCGAACTCTCATGCTCACGCAGCAGCACCAACTTAGTGCCCAAAGCCAGCAGGACCTCTTTGCC
CAGTTGCAGTTCCAGATCCAACGAGACAGCGGCGCAGCGAAGATCCCACTCGAGCGCACCACATCAACTTTAGCCGCCAACATCGCGATCTACGCGGCGT
ACAATATCGATCCAGAGATCGTCCAGTTCCCTCCAGAAGAGATGACGAAAACTGGTGAATCCCAGAAAAATGGTACCTGACGCGTACTAATTGTGAGTTT
TTGTTATAAATAACAGCGTCTTTGTATCCAATCAACTGAGCCGATCTAACCTCCGATCTGCATTCTTCAGGATATGAAAAGCCATGCCGCTAGTTCAGAA
ATGCTGCCGCTTTGTCGGTCATGATCGCCCATGCGCTCTTCGTCATCAGCAGAGTGGCCAGGTTCACTTCTGGGACATCGTCGCTGACTGTTTTCAAAGC
CTGGAGCTTCAACGACGAAGACGAGGATGTCAGCGAAGATGTTGCCGCCTGGCGGAATGAGCCTCGCCGCAGCAGCATCGAGTCGATGAACGAGCTGGAG
CGGCTTAAAGCTTGTGTTTCAAAGAGAAAGCTGCGCTGGTAGTTGGTCTTCGAGCAGAAGAGCTTGTCGCGAGCGCACACCTGGCAAGACGACTCGAGGA
TGAGGACGTGGTCGAGCTCCTCGTCACACGTGTCTTCCGAGTTCGACAATGTTGATGGCGTTCTGGAGAGCATAGCGCGTTTTGACACGGCATCAGCTTC
ACATTCGTACTCTGGGGTTGAGCTTGGTACCCAGGTCCAGTCTCCTGAACCAAACGTGCCCAGAAGGATCTGCTCAGTACCAGCAAGCTCCTGTAGAGCG
TCTCTACCAAGACTTGTCGGGTGGAAGCGCAGGAAGCAGGGCAAGCGTGAGCTTGAACTCAAGCTTGAACTGGTCGTCCTTGGTTGCAGCACGACCACAG
GAGCAGGACGGTTGCCCACGAGAGCCCACTGGGTGCCCTGGAAGAATCGATGCTGCTTGACCTCCCCAGCGCCAAACCGGTGCCCGAGTCGCTTCTCAGG
GTGTTTCTCCAGCAACCTACGCAGAAAGTCCTTGCAGTCGTCGCTCATTTTCGGCTCAGCAGGGAACTGCACGCGGCACTTGAGGATCTCCTTGAACAGC
ATCACGGGGTCGCTTGCTCCCCTTCCATCTTGGTTCTCGTGGCAGGAGCTATCATTCTGATTGTTACTGAATGGTGGCGTGCCGTAGATCAGTTCATAGA
TCAAACAGCCGAGGCTCCACCAGTCCACGTCCGTGCTCTGGGGCTTCTGCTGGATCATCTCGGGCGGCATGTAGTCCATCGTCCCCACGAACGACGTCGA
GCGGAGGCGCACGCGGTCATCCGCTCCATAATAGCTCTGCGACTCGCTGTTGTTGCTGCTACGACTGCTATACGGTGAAGCAGCAAGACATGAACCGATG
TGATCCCCGTGCTGCGCGACACCAAAGTCTGTGAGCCGAATGTGGCCATCTGTGTGTAGGAGCACGTTCTGGGGTTTGAGGTCGCGGTACACAAAGCCCA
TGGTGTGCACGTACTCGAGCGCGAGTATGAGCTCAGATGCGTAGAACTTGGCGTCTTGCTCGGTCAACGTCCCGCCACAGAAGTTCTGAACGTCTTTGAG
GTTGCCGCCTTCGTAGAACTCCATCACGAGGCAGAGGTTCGCGCCGTCCTGCTCAGCAAGAAGGATGAAAAGAAAGTTTATGGTTGCGTGAGTCTGCATG
GTGCACACGAGCAGGATAAGAGCCATAATGTTCGGATACAGGGTGTATTGTACCTGGAAGGCATCATGCAAGCGAGCAATGAATGGATGCTGGAGCGCTT
TGAGAATCTGCAGCTCCTTGAGTGCTCGCTGAGTCTGTAGAAGGAAGGGAGAGCCAAGTCAGTCACTGACGCGTCGTTCATATATGAGCAGTTCCTGTTT
CATGAGTTTACTCAGTCATACCTGTCGGTTCTGAGACTCCACTGCAGTGGAGATCTGCTGCACCTTCAGTGCAAACATCTGCCGCGTCGCGCGATGGCGC
GCGAGGTACACAACCGCCGCGCCGCCCGTGCCCAGCAGCCCCAGCTTCTCAAAGTCCCGCAGCGATGTGAGGCTCATCGCACTGCTGTTGCTGTTGCTAC
CCTCCTCGTTAACACGGTCGCTCATGCGCTCTGGTTCTTCTTCTGGTGTCTCCAGCAGCTCGGATTGCTCCAGTTGCTTCATGTCAGCTTGCTGCTGCTT
CTGAGGGTTTACTCCTGAGTTTAACAACTCAAGAGGAGCAATCAACCCGCTCTCGTCACCCACCAGTACGCCACACGTTCCTGCATTTCCAGTCACTACG
CCACACGCGGTGGTGCTGATACAATTCCTTCCTCTCCGCTGTGACATTCGCGTATGTGTGACCCCGTCTGCGCCTGTGGGCAGCACCACCCGCTCCTTCT
GAACCGCGCTTGCGCCGCAGGTCACGCTCGTGATGCTTTGATTGACCATGACGCTGCAATAGCGCTAAGCAGAGAGATGTGGAGATGTCTGTAGTTGTGG
ATGGATGGATGGATGGACAATGGACAATGTAGCGCAAGTGCTAAGTGCCAAGTGTCAAGTGCCATGTGAGATCACATGTTCCCATTTGACTGACCTGTTT
GGACCAGAATGGAAAAAGTGAACCCACCGGCAAGCTCATTTGATTCGATGATTTCTGAGTCTGAGTCGGGATAAACGCCGTGCCTGATTTTTTCGTAAAG
TACGCAGGTCTCAGAGAAATTTATCAGGTTTAGTACTTGTGATTG