Description :
From Genome Similarity Track
Location :
Scaffold_135:14921- 17898
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_135-abinit-gene-0.23Conserved gene of unknown function

Sequence
2977 bases(100 bases per row)
AGTATGTGGCGGCACTGGAGCAGGAGCGCGAACGGCCCGAGATCCGCGCGTTCGCGGACAACCCCGAGATGTGGCAGATGTACATGAGCGACCTCTTTGA
CACGGACGCCTACTTCCGCCTCACGTTCACGGGCTTCACAATGTACCGCGAGGCGATCGAGCACGACACGCCGTTTGAATGCGACCTCAAGGTGCTGAGA
GTGCCAATGGAATGGGACGGACTCGAGACGATGCGGCGCTACGACAGACTCTTTGACGAATACGCGGACGCCGAGGGCGGCGTTGAGCTCAAGAGCGCGC
TCTACCTGTTCGCTGAGAGCGGCCACGCGATCCCGCTCCAAGAGCTGTGCGAGACACTACAACGCCAGCGGTTCCTCGCGCGCTGCTTCAAGTCGGTGCT
CAGTCGCAAGCGCTCGCTGCGGCTCTTTGGCTACAGGCAAAAGTCGAATCTGCTATACACGAACCCGCAATTGGAGGACGAGTCTAAGATTTGCAAGCCC
GCGTTTCTGAGCCTCATGCTCTCGGCCTGGGCTCCAGCACCTAGGACGGTGGGCTTTGCTGTACTGCTTGATATCGTTGCGAGCTTGGACCAACTGATCT
GCTTCATTTACTGTTGACGCAGCGCTGGCGCAGCTGGTTCATGCGGCTCCATCTGCAGTCATTCACGACCCTGCGGCGCTGGCGGCGGTCAACCTCGTGG
GCGTTTGACAACATCAGACAGGTCGCTCGGACGGGACTGCTGCGGGCTAGCTGTTTGCTCTCGAACGCACAGCGAGAACGTGGCGACTACGTGCTCAAGT
TGGACGTCGGCTCCCGGTTCTCGTCCCACGCGACCGTGCACGTGTCCTACAACAGTGACGCAGACTGTACGTAACTCGGGAGTTCTCTGTGCTTTCGTGC
AAGTCTGTAGCTGACTGACTTACGTGCATGTGTGCGTAATATTGGCTAGCTGCTGCGACGTTGCACGAGCTCAAGTACCTCGAGCGAGGGGCCGAGTGCT
TCGTTTATATGGATCTCACGTGTCGAAGCGGAGCCAAAGGTGAGCTTTTGGTGAGAGATGAACATTTATAAGCCGAATCATCTCATACGAAGCTGTCATG
CAACAGAGAACGACATCCAGTGGCTCTCGCAGCGGCTCACGTGGTTCCTCCACGAGTTCTTCCGCGATCATCTGGAGAGCCTGCCGTTCTTCCACAAGTG
GTTTGTGACGATCCCAACCAAGCTCCAGCTGCGATCGGGACCAGGGGCTTCCGGTGGCGGTGGTTCATCGTCATCGTTAACGAGCTCGGCAGTCATCCGC
ATTGCGATCCTGTTTGGCGGGGGAATGGATCTCTACCAAGTGATGCAGAGCCTCAATCTGCCGTCGTCGATGCAGTTCGATCATTTGCTACAGCGCCTCT
CGTTCCGATTTCTCTGCAGTCACTCGCTCGAAGAAATCTTGACCAGCAAGCGTCTGGACTTTGGCTCCCAGTGGGCGTGTCGCCTGCAGCTGGACGCCCG
GCTGAACAAGCAAGCGTTGGCGCAGATCCTGTTGCAACTGGCAAAGAAACTGGAGACGGATGCGGCACAGGAGGTTGAGGAGATGGAGTTTGTCGCAGCT
GAGAAGGCCAAGAAGATGCATAACGAGTCGCAGCAACAGCAGCAGCAATCGGTCAAGAAGACCTTAGCTCCAGCTGCAACGCGAAGCGGCTCACACGGTG
ACGATCATTTCAACAATGTTATAGCCGACGAGAAATCCCGAAATTTCAAGACAAACAAGCTCACCAGGATCCGCGAGTGGCTCCAGAAAGCCGCTGACGT
CATGGGCTTCTCGCACGAGGTGAGTGCGACGCTCTCGTATGCGAACGTGAACGACGCGCTGCTCGGGAACCGGTGGATGGCGAGCGTGCTGTCGCCAAAG
CTCTTCCGGCACGTGAAGCACCTGGTGACCACCCATGGCGGGATCGCGTCGGAGTGGAAGAGCGGGTGTGACTCGTTCCGGTCCGAGTTTAGCTCCACAC
ACTACGCTCAAGGCACAAGCACTGGCTCACGAACCTTATCAAGGGCGTCCTCGAGATCGTCGGCAGTCCACGGGCTTGAAGACTCGTCGGCTCTGGAGCA
CTCTATCGCGGCATCGTTCCCGTTTGCAACGCCACTGTCGACCTCTAAATCCCACAAGCGACCACAAATTCCAATGCCGTCCTCGCGACAAGAGACAACT
GCTGTGGCTGGAGTCGGCGATGCGAAAGACGCGCATGCGAGTGAGAAGAAACAGCGCGATATGTCGAAAGACGAAGTGCAGGAGAACGAGCTGCTGGAGC
TCTACGACATGTGCACCAAGCACCTCATGGGCGTGAGCGTCATTCGCGCCGAGGCCGGCACGAGTGGACTCACGTGCATACTCGAGGGCTGGAACATGTT
CAGTCTCCTGCCGCGCGCGGCGGCGCAGTCCGGTCGGAGAAAGTCGCTCGCGCGCACAAAGAGCTCGACGTCGACCACGTCCAACTCGGGCTCGGTCGCT
GGACTCGGGAGTCGCAATCGATGAGATGACTTGGGCAACAAACTAGAAGGTCGGAGTCAAGTTTCAATTCATTACGAATACGTTATAGTGTGCAGAGCCT
ACTGACAACTGAGGTCTTATGCATGTAAATCGATCGCTCTCACCATGAGGTTGCTGTTGTTGATTGATGGTCAGTGTAACTATGACAAAGTAATTTGCTC
ACAGAAAGGGTCGCGTTCCAAGACGGTCGGACCCTTTTCACGAAGATATTCACTGTCTTCATTCCATCGTTACATGCAACAATGTCATACACAAGCACAC
ACGCACGCACGCACGCACACACATACACACAAAGAAAGCTTGGGTGGGGACGGTCAGTGTAACTATGACAAAATGAAATGCTCACAGAAGCGCCTTCAGG
CCATAACGGCTGCGTGACGCTTTCACGGATTACGTATAATTATCTTCACTCCATCGCACCAGCACAACATATATACA