Description :
From Genome Similarity Track
Location :
scaffold_57:14919- 17062
Transcript NameFunction/comments
g2318.t1hypothetical protein

Sequence
2143 bases(100 bases per row)
ACCAATTGCAGATGTTTGTGGTCGGGTACTGCATCATCGTCGACGTCTCCAGCACTGCAAAGGACGTGGTAACGTTGTCCATTCCGAACTTGCCGAAGTC
ACTGATCCCCCCTTCGCTCGTGTTTACCACCGTCGCCTTGCCAGTGCAGTTGTTGCCAACATAAAAGGCAAGTTTCACCTGGTGGTCAGCGAAGTTTGAT
CCTTTAATCGGAATCCCCGTCCACCGAGCGGAAGAAATACTGCCGCTTAAATCGGAGCATGGCATGTCGTAGCAGAGATTCCCTGCGGAAACGCCAATGA
TGCGGCGAAGTCTCTTGAAATCCGGCTCCTTGTAGATCCGCAGCTCGCCTTGCATTGCTCTCGCTGTCAGGATGCTGCAAGCGATCACAACAACGACAGA
GAACGACAGCACTGACACGAGGCGAGAAACCATTGTTTGATGTCCAGTTGCACTGCAAATTGAAGACTGAGCCGTGTTTCAGATGAACCGCTCGCTCGAA
TATTTCAGGATCACAGCCTTACACCAGGAGATCAAGATCGTGTTGTCCTCGTATGACCCAAGCAGCAACGTTTCACGGCTAAAGTCCGCACCGACGCAGC
TTATATTTTCATAATCCTGTGCTACTGCTAATTGTACATGTGCGTGCATGGATCTCCATCAACACGACACGAATTCACCTCCAAAGAAGAGATTTTTCAC
ACCTCGAAAGGCCCCCCACGTACGAGAAAAGAAGAACATGAAGATGGATCCGAATTCGCCGTCGTGCGAGAGGTCTTGGTCGTTGCCGAGCTCCCGGATG
CACTGTTGGTAGTGCTCTACATTCGCCCCTCCCGGGTGTTCGGAGGGGGCGTACGAAAGTCCACCATGCGAAAAGGATTCCGTGAGTGACTCGATTTTCC
AGCAGCTATCAGAAACAAGTCGTCGACGCACGCCATGGCGGCTAAGCAGGTGTGATAGATAGTAATCGTCGCCAAGGTAGCAAGCCTTGGACATATTGGC
CACCTCGAACGCTGGCATCGTCTTTTCCTCCATACCGAAGAACTTGCGTTTAACTGCAACACCACCAGCTCCTCCTACAAACGAAACACTGTTCACACCG
ACCGCCAAACTACGTCCACAGTACAGTCCGTCTTCCGCTGAGATCCACCCGCCCAGCACTGCGATCGCGTCGCTCGGGTACTTGTGCGTGTAGTGCAGCG
CTCGTTCACACAACTGAGGTGGGTACATCCTGTCGTCGTCACCATAGACGATGATGGTGTCCGGGTCCTGTTCAACTAAAAGAGTCCCCAACACTTTACT
TGACGGTCCGAAGTCTGTATCGAGCACGATGAGTCGCAGTTTGACATGGTACGGACTCGATCCGGTAGCGAAGGTGATGCCACGGAATTCAGTTCGGTTC
AACGTCGCGTCATCTTCCAGAAGCCAGGACGGGATTTCCACCACCTTTTCTCGGTACATTCGAGGGACTATGACATACACCGCGTCGAACCCATCGCCTT
CTTGTTGCACCAACGCATCCACCGTAGGCTTCAACTCGTTGATTCCTCTCGGAGTTGTCGTGAAGCTGAAAACGACACGCGGTCGCGCCTGTGCCGCACT
CATGGAGGATGTTGTCCTGGGTGTGGACGAATGGAAGGAGAAGAGGAAGAGGATGATCCAAGCGACGGAAGTGGCCAAGAAGCACGCAAACCACCGCTTC
CGGGCGTTGAAGTCGTTGTCAGGAAGCGTTGACGATTCCAGGACGATTTTCTCCGGCAATAGTTTCGCCAATTGACGGGTGCGTCGTCGACGCCGACGGT
GCCGAACGAGAAGAAACGTGAGTGCCGACAGCCCCGTAAGCAGTGAAAGCAGCGAAATTCGCGGGATCATGACCTTTTCCGCGTACAGGTCGATACAGGC
GTCGCCGACAGACGTCCGCAATGACTGCGTGGCCATTTTTGGTGCTTGGTTGGTGGCAATAACTTGGCTAGTGAAAATGTGCCGTCGGTATCGGCCGCTG
TCGCACGCTTCGGGCGGCTTCATTTGCATTGGATGGTACCGGCATTGAAGGCACAATGCGACAGACTCGGCCAGCTGGCAGTAGGATTGTGTGCGAAAGA
TCAAGTTTTCTGAAGTAAACAAGTTTTGATATGGCATTTAAGA