Description :
From Genome Similarity Track
Location :
Scaffold_35:149186- 152456
Transcript NameFunction/comments
Phyci_164918Hypothetical protein
Phyci_156751Hypothetical protein
Phyci_160358Hypothetical protein
Phyci_160310Hypothetical protein
Phyci_155858Hypothetical protein
Phyci_164471Hypothetical protein

Sequence
3270 bases(100 bases per row)
AGCTGTGATGTGGACGTAATGATGGGCACTGCGGCAGGACCTGTCAACGTGGCCAACGTTCGCTGTATCATCGTGGATGACGACGAAGAAGAATTCTTGC
TCGGAAATCCGACGCTGGTCGCCCTCAGCATTGATGTGGGCCGCCAAATGGAACAGTTGGCGATGAGCAGCAGCGGTGTGTATAGCGAGGAGAATGACGG
CCTCCCGGACGATCCCGAAACTGGTCAAGATGATGAAGCAGAGGTGCAGGAGCTGCTCGACCAGTTGGTCGCTAACGCAGGTGATAATGTCTTCTCCCCG
GAGCACATGTCTACACTTAGACGTGTGGTCAGCGACTACCGTGATATGTGGAGTATTCGTGTGGGAGCAGGAGAGCCCGCGCGTGTCGAGCCCTATCGGC
TGCAGTTGAAGGAAGGTAGCCAGCCTGTTCGCTGTAAGCCGCGACGCTACTCGCCCCTGGCCAGCACTTACACGAGTAACTATGTCAAGCAGCTCGTTGC
AAGTGGCTACATCTACCCGAACAATGCCAGTCGCTGGGCAAGTGCTGTCGTTCCAGTTCCAAAGGCGGATGGAGAAGAATTTCGCATCACATGTGACTAC
CGCCTTATCAACAGCATGACTGTGCCGATTGCAGCAAGCGTGCCGAACCTAGCAGTTGTATCTCAGTGTGTGAAGGGCGATAAGGCGTTGGGCAAGttcg
acatgcttaaaggcttttggcagctccctatccacgagtacagtcgggagccattcagctttcagacggacgagggcgtttttactcccacacgagttcc
ccaaggtgcggtggactcagccatgcatttccagtccactatgcaggctgcatttgcagatctaatcaacgaccatttgcttgtctacgtggatgatgtc
gttttgtacgctggttctcatgaggagtacttggaggttttgcagcggttcttcgcaagactacgagaactcaacctgaagctgaatttgaagaagagca
ccatctaccaagatgctgtatcgtggtgtggaaagatcatcgatggacaaggggtgacggatgaccctgctcgagttgaagctctgacctctcttcctct
gccagagaatgctgcggagctgcagtacttcctgtgcgctgcgaattggatccgggattctgtggttgattatggcagagcggtggctctattgcaagCC
AAGTTCGATGATGTCATGAAGGGCCATAGCCGTCGGAAGCGCCATGCCGCTAGTGTGGCGATTTCGTGGAGTGACGATGAGGTCGCTGCATACCAGGCTT
TCTTGCAGCGCCTGGGTAGTTCGGCAAAGCTATCCTTCGCTGATGATGAAGCGATTGTCTGCCTTAGCACAGATGCATCGGATCGTGGCTGGGCAGTGAT
CCTAACTCAAGTGAGGTGCTGGAAGGATGGGGTCCCGGTTCATGAGCAGAGTCATGAGTTGCTTGTGTGCAAGGGCGGATCGCTCAAGGGGTCGCAGCTA
CAATGGTCTGTTGTTGAAAAGGAAGCCTACCCGGTGGTGTACGCGGTGTCCGAGCTGGACTATTTGCTACAGAGACCGCTTGGGTTTCGCATCTACACGG
ATCATGCGAACCTGATCCAAATTTTCTGTCCAAGTGCCGAGTTGAAGAAGCACGTGCGCGGTAAACTCCAGCGTTGGGCCATGAAGCTAGCTGGGAGCCG
CTACACTATTGAGCACGTCAACGGAGAAGATAACCACTGGGCAGACTTGGTTTCGAGGTGGCCAGTGCGGGAAAACATTGAGACGTTTGTGAAGGTGAAG
GCGGTGAGGACCCGCAGCCAACGAGAGCCGAGCCTACTCAGACCATTGCAGGATGAAGCATTTGAGTGGCCTTCGCTCGAGGCGGTTGGCACTGCACAGT
CTCACCACAATCGTGCTCGGCCAAGTGGTGCCGAAGAGCGTGACGGACTAGTGTACGTCGATGGGAAACTATGGATCCCGATGCAAGAGAAAGATCTGCT
GCTTCGGATCCTGGTCGTCGCTCACTGTGGAATCCAGGGACACCGTGGCATTGATGCCATGACGACGCAGCTCGAGAAGCGTTTTGCCATCGCGAGTTTG
AGCGCTGTGATATCGCGctttgtgaatggatgcctcttgtgtaaacatatcaaaggcggccagctcattcagcgcccgtggtcagAGACTGAAACCGCCA
CCAAAcgcaatgaggtgctgcacatggattatctcacgatgggagaagcgtatggcaccaccaagtacgttctggtattgaaggatgagcttacacacta
ctgtgagcttgtcgcttgcgacgctccaacgagtgacgtcgcagtggttgcaattttggacaggcacaagcgctttggcctccccgccaaatggtccact
gataatggcagtcatttccgtagtgctgtcatggcggagctcgcgaccagactgcgtggtctgcagagttttgtgcccgtctacacgccttggattaacg
gaactgtggagaggattaatcgcgacatattgcaagtcgtgcgtgctctgttactcgagctgcgactcgatacacgcagctgggagtaccttttgcccgt
ggtccaagctaatctgaaccagacaccggtggtgtcgcttggaaacaagtcacctatggagctatttactgggctcccGGCATCGACCCCGCTCGACACC
TGCTTGCTTCCTGATAGAGGCGAGCCGCTGCAGGAAGTCGACCTGAGCAACGTTGAGGACTTTCTCAATCGGCTGCGTGAGAGCCTTCATTCCATGCACA
TGGATGTTGCAGATCGCAAAGAGAGACGGAGGCTATATCAGCAAACTCGCAAAAAGGGGACGACTTGTaacttctctgtcggcgattttgttctgtggag
tcgaattgacacgagactcggtgagggcaagctgctcgtgcgctgggtaggcccatttcaagtggttgaagcgaaatcgcactcattcatggtgcgccac
ctgctgacgcaagctctgcacgaagtgcacgggtcgcgtctgaagtactaccatgaccccagtcttgaggtcaatgaagagctcgtcgagcatgtggcga
gccaagggctagtgctgggtgttgagagcatcctaaatcatcgattcaacaacacgactcggcgacatgagctactagtatcttggatcgggctggaatc
cattgaagactcctgggagccgttGTCTGTCATGCTTGCGGACGTCCCGGTCAAGGTGAAAGAGTATGCC