Description :
From Genome Similarity Track
Location :
Scaffold_94:14916- 35161
Transcript NameFunction/comments
Hyaar_Emoy2809079hypothetical protein
Hyaar_Emoy2900043HaRxL47
Hyaar_Emoy2809080hypothetical protein
Hyaar_Emoy2809081hypothetical protein
Hyaar_Emoy2809082exosome complex exonuclease RRP45-like protein

Sequence
20245 bases(100 bases per row)
CACGCGCGTCCATTGTTGATTGGACCGCTAGAGCTGGCTGATATGATGGCCCATATCAGCCAATCGGTGAGCGTTGCTGAATATTACCCCTTATGGTAAT
ATTCACGAACATTATCGACCTTCATAATGATATTCTAATTAGTAAGTATCAAGGGTTAATTACGTGTAACAGGCTCACCCCGTTACATCACCCCCCCAAA
CGATAGTCACTCAATCACTATCACGTTGATATGGTCATTGTTAGACCACATTAGGGACAGGGAGCACTTGGTTTGGTCTGATCCATTCATTTCTGGATTT
TCATCGCATGGTAAACAATTCCATGCGATGCGCGGCTAAGTCTGCTGAGAAGGCAGCTGCGCGTGTCAACGCAGCTGTTCTTGACGATGCCCAGCCTCTT
GCGGCGGACGATGCTTCGTCTGCTGCCACTGCAATTCTTCCTGCAGAACCAGTTGCTGCAGATGCACGTGGTGAGTTATCACGTGCTTATGATGATGGCT
CCGAAGTGGAGCTTATCTACTCGGGGGAGTCGGACAGTGAGTCCGACCCGAAGAAGATACCTGGTTTACCTGAGTCTATAGTGGCGGCCAAATAAGAGCC
TACGAATAGGACTCGAGTGGGTAGTCAGACTCATGGTCACTACCGGAGTCTGTTTAGTTCGGAGGATGAGCATGCTGACTCATCGCTCGCGCCTGCTACT
GCACATTCGCCTTATAGCGAATGCGGTGATGACTTGAATCGTAGTGATGAAGATTCTAGTGGTACCGAGAATTCCGTTGGTACCACACAGGAGGGTCTAG
ACGGCAATGTGTTGCGTCTATCCCCTGAATACAAGTCTTGGGTATTACCAGAAAAGATTGTGGATGACCTGTCAGGCAAGACAAGTCTTCATCATCAAAT
TCCATTATTCGATGCGAGGCTGTTGCACGGGCTCGACATCAGCGCTAGTAATTTATCGCGCTGAAGAAGACTTCTATCTGGATAACTTTTCTGAAGCATC
GTTGTTATAGTGGCAGCACTAGAGAGACAAAAACTCGTTGCTACAGGCGTGGAACGCCTTTATACTCAATGTGCAGCACATTGGGCGCGAAGATTGGCTT
CGGAAACTTGACACAGCTCGTGCTAGGTTTGAGAAACGAACCTTAACTGGTGCAAAAGCCAGGTTGTGCAAGCTGTCTCGTTAGGCAGGAATTCCATGCC
ACACGTGCGGTGACCCTTGTCCGAGTTGTTTCGACAAACTTAAACGCATCCAAAGGGAGATGTATTCCTTTTCTTCGCCCTGGGTTAGGGCACACACATC
TTCTGAGATGCGTGATGAGATTGCTAATCTGCAATCGCTCTACCAGCAGCATGGGCGTGTGTTTTCCGATGCCCTTCTGATCCATCGGATGTGTCTCGTC
GTACTGGTGGACAAGACCCTCAACGTCAATCATCAGCTGGGCGCGAGGCACCCAGCTATCGTGTGACGGCGGATAGCCGCGCCAGCGAACAAGATAACTT
GTTCACTGCCCCTTCACGTCACGGTGGTTCAAGATACGCTCCACATGAAAGCGTTGACTACTGTGCGAGTCACCAATGGCTGTGGTGGGAATATCAACTC
CGAATTCGTTGGAGTTGCTGGCAGAGGTTGGTCGTCTCCAGTAACGCTTACACGATCTGTGTGATCGCACCGTTCAAGAGGAGCGTCTCTCTTTGGAAGC
GTAGGTGCAACACATCCGCCTTTATCTATCGGACGACCGACTGGAGTTCGCGTTCTACCGATTGGAGAACGAGTGGAAGAGTCAAGCCTTTCGCGACGAA
GTGGCTGACATTCGTCGCCAGCATGTCGCTCTAAAGAGCCAGATTGAGGTTCTGGCTCGGGCCCAAAAGAATCTCTTGAAGGTTCTCGAGCGTGGCGGTT
GTATTCGCCCGAGGAAGAGACCTCGTGTTGATGGTACGGGCGCAGAGATCGACATAAAACGTAGGATACGTACGCATCCTGCGAGGCAACTCGATTGTGT
ACGCATTGCCTTTGCGATGTAGTACACGAAACGGGCCAATGTAATTGGATATTAGTTTACTACTACCCACATTAGTTACTACGTGCTTAGGTAGATTTAC
CGTAGACAGTAGAACTAAGTCTCCAATATTAAATGGAAGAACGTTTACTTTTCCATGTTTTTCAGCTTTCCGTTTCTGCCGGTCCACCGCTTCTCGTGCC
AGCAGGAAATCTTCTGCTGAATCAATTTAGTTTGTTGTATTGCACGTTGTGTGCACTGCTAAGAGGTCATCATCTTTTTCAGCGAGGGTGTTCTCATCCT
CGCTGGTGTAGTCATTGGAGATGCTAAATATACCAGCATCGTCATCCTCATCTAGGTAAGCAATTGTGTCGTCACTATTGCTGAGATCACCAGATTTGAT
CGACATAGGCAACGTTCGCGTCGTCGATTACCTCACCACGTAATGAGCAAGAGCCAGAACGGTTTTGCTCGAGCGAACACCTCACCCCTTGAATTAGTGT
CACACTATAAGTGTGTGGGTAGGCGTGGATGGCGTAAGCCGTTCACGAAAATTGCAGTATGCGTTGTCGATGCATGCACGGAGTTGTTGATTGCAAACTC
CACCATTGTTAGAAATTCGCTTCAATCTGTGAAAGATTGGATGTATCCTCGAAGTATCTCTTCGAGGACGCGGTTGAGGCGTTCTGTCTCACCATCAGTC
TCGGGATGGTCCGAAGTATACATAATCACACGTATTCCGAGGGATCGGAACACAAATTGCCAAATTGCCGCCGTGAACCGAGAGTCTCTCTCAGATACTA
GTTCACGGAGTAGACCGTGGAGTCGGAATACCGTGTCAATGAAGAAACGGGCACAACCATGTGCTGAGATTGACTCATTAACTGTAGCAAGATGTACCAT
CTTGCTGAATCGGTCTACGAACACAAGAATACCGTTATTCTTGTGAGCATCTTCGGGGAAACCGAAGACGAAGTCTATTGAAACAGACTGCCAGCACTCT
GCCGGGATCGGTAGAGGCCGTAGTGGCGAACGAGATGAAGGACTGGGCATCACCCGTTGGCACACTTCACAAGCACGAATGTACTTGCACACAAACTGAT
ACTGGCGGGGCCAGTAAAGTCGTGACTTACCGTGAGACAAGTCTTTTCACGCCCACGATGCCCACTAGTTGGTGCATCGTGGCACTCATACAAGATGTGC
AAGCGCAAATCATTATGCGTAGGGACGACGACACGAGGTGAGTGGCCGGCAACTGCTGTATATTACAGAAACCCGTTGCGTGTTCTGTATCAATCCGCGG
AAGATCGATACAAGGCTGGTAAATTTTTGAGAGATTTACGAGATCGAGTCGCCAGATGATCCATTCGTCGCAGAAAAGCCTTATCTTCTGTGTAGACCTT
TTTTATGTCGTCAAGCATTTTTAACGACGGAACACTAGTGACTAGTGTTGCTTTAGTGGTGTTAACCCCACTGTTGGACTGCGCAGCCGACTCGAAATCG
GGACGGCGCGACAACGCGTCCACGATGACATTGAGTCGTCCGGGTTTATACTCTGCGGAGAACTTGTACTCCGCAAAGGAGGACAGCCACCTCTCCATCC
TTTGCGAGAGGTGTGGGCTGTTTACGGCCGTGCGGTAATGACGCATGGTCCGTATAGACTACAAACGGCCCATCTCCAAGGAGATAGACGCGAAACTTCG
CTAGTGCATATTTCATGGCAAGACATTCCTTGTCGTGCACTGGATAATTACGCTCAGCTACTTGCAGCTGACGCGATTGATAACAGACGACACGCTCTGC
GCCGTCTGCATCGTACTGCATTAACGCGCAGCCGATTGCGAAGTCGCTGGCGTCACAGACCACATGGAATGGTCTGTCTTGGTCTGCCATCGTCAAGATG
GGCGATTGCATCAAATTTTGCTTGATACTTTCAAAAGAAAGCTGATAATAAGTGTTCCATGACCGGTTCTCGTTCTTTTTCAGGAGGCGAGAGAGATGAA
CGGTCATCTCGGCGTAGTTACGCGAGTACTTGTGTAACTATGCCGCTAGACCAAGGAACTTTCTTAGTCCCTTAACGTCGACTGGCACAAGCCAGTCGGT
AATCGCCTTGATCTTTTCAAGATCAGGGTGTAAGCCGTGTTTACCCACGATGCACCCAAGCAGTGGTGTTTCGCTAGCAGCGAATATTCACTTCTTGAGG
TTGACATACATCTTATGCTTGCGCATAAGTTTAACAACCTGACGAACGTGAGTTCCATGAACCTCTACGTCTGTCTTTCCTCTCATAGCCCGGCTATGGA
CGAATACATCGTCGAAGTAACTCGGTGTGAAGTCTTGCACCGGTCTCAACAAATTTGTAACACATCTGTTGAAGGTGAAACGGGAGTTGCTAAGCCCTTG
TGGCATTACTAGCGACTCCCAGAGCATACCGCTCGGGGTGCTTACTGCTTTGTACGGGATGTTCCGTTCACGAATCAGTATCTGATAGAAGCCATCCATC
AGATCCATGGACAAAAAGATGATACTCTTTGACATACTATCAATGATTACGTCCTTCCTCGGTGTCGGCGTCTTAGCCGGTACCGTTGCAGCATTCAACT
TGTTCAATGCGTGCAATCTCCGCCATCCTTCTGTGGCCTTGCGCACACAGAAGGTCGGAGAGCTGTGAGGGGAAGTTGACTCCCTCACATGACCCTCAGC
TAAGAGATCGGCAAAGAACTTGTCGATTGCAAGCACTTGTTCACGAGGCAGTGGCCACTACTTCATGACAAAGTACTTCGAGCCCGGTTTGAGCTCGATT
TCATGTCGATTGCCTTTATCCTTAGGCAATTTGCATGGTACGGATTTGGGTAACACGTCCTTGAATTCGATCGAATCCTTATACAAAGGATTTTCCTAAA
GCGACTCCCAAGATTGAGACGTGTATCGCTCAATACGAGTCTTCGCATCGACGACTCTACATTACATTGATGAGCTGCTGAGAACTCGTTCGTTCTCTAC
ATGTAATACTGTCGACAGAATGTCAGTCACGTACGCGTCCTTTATGACGAATACACAGATCTGCTTGACCTTGCCACTACGCAGATCTCGCAAGAACCGT
TTCTGTTCTAGCGTTGGCAATTGAGTGATCTCCAAAGTCAACTTCGAAGGTGCGATCAGATCAAGTGTATAAGCGCTTACACTTGACCCGTCATTAACCA
AGACATTCAATGTCTCGGTTCCTTCCTGAGAACCCTTTTCCATAGGCTGTTGATGACTTATTCCCTCTACGTCTTCTAGCTGTCGTTGCGCTACCACAAC
TAGGTCCTCTACTATCTACTCTCTAGCCGATCAAGGTTCATAGTCTAGCCCTGTATGGGCAACTGGTTTATTCTTACATGGATGTCTCCCGCTAGGCGTA
CACCCATGTCCCGATCCACTCGACTTGTTCGAGTGGTGGAACTTTGGCGCTGCCTGTGCATCCGTACAGCCGCCGGCACAGGTTCCTCCTCAGTGTGATT
AGTTGTCACACTGTGATCTTGTGCAGTCGTACTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCACAGTACATCCCTTGTGGACGCTCCAAGAC
GTTCATCAGATCGCCATCTGATGAACAAGTGGCAGGCATCTTTACAGTTCGATACTGCCAGCTGACCCTTGGCTCGTACTTTATGAGCCAGGGTAACCCT
AGGATGATATCAAGTTTGCCATCCAAATCAAGTATGATGAAAGCATCATTGTACTGCAAATCTTCTAACGTGTAGTGAAATCCCACAACACGTTTCATCA
CTGATATCAATGCGCCTGTTCCGAGGCGCACCGTCAACGTCGTAGGAAGAGTAAGCGCGCTCAACGAACTTGCGCCTACGATCCTCTAGCAAATGGCAAC
GAACAAAGTTGTTCGACGCCCCACAGTCAACTAAGGCACGAAGTGAAAAATCTTTTGTCACTTCTAAGTTCAAAGTGGTGAAGGGTACCTCATCACCAAG
TGCGGAGACACAAAATGATTGTGAGTCTGGAGCAATTTTCATCAATAGGTTTTCAAATTCAGTTAAGGTTGCTGGATCAGTAGAGCGCTCCGCCTCTACT
GACCACGACCGTTTTTTGATGGTCTGCTACGATGTTGTGACTTCGCAACATCGTTGGACTCGGGTCCGTTGTGCTTCTTGGCAGACGGTCTATCACTTCG
CTCAGTGTTATGAGACACTGGGCGTGAAGCACTACACTCGTAGGCATAGTGTCCTAACTTCTGACAGCGGTTGCACTTTTACAATCGCTTACTGCTTGAA
GAGCGAGGTCTCTCGCTCTCGACACTGCAGAGATCCATTGGTTCTGGACCTCCCGCCTTTACTCGTCTCGAAGAACCATAGGGGGTCAAGCTATTGTGAG
CCTGTCTCACGCTAAAGTCCTCTTGCATCGCAGTTGTAATCGCTTCCTCAAGCGCCTTCAGCGCGATGAGGAATAGGTGGTCCCTCACTGGACCATCCAT
AAGGCCTTATAAGAATATCGTGATCAACACAAATTCACTTACAGGGTTCGCTACCATTCAACTTGCAAGGTAACGAACGTGCTGTGCGTAAGCGTTAACG
TCACGCGTACCTTGTTTTATGTTCAGGAGATCTGAAAGAGTCCTGAACTCAGCTCTTGGCGGCTCAAACGTTTGGCTGAGAAGAGTCTTAAAGACCACAA
ACGATCCAAATACGTTGGATCGTGTAATTGAAGATTCAGGGCCCAAGTTCTGGCACGCCCTGACAAATTCGATTTGGCAAATGCGGCTTACAATTGCCCA
TCAATGATGCGACGAGCCTTTATGGCGTTGCTCAACTCTACGTATCATCACATCAGGGAGTCTTCAATGAATCCGCGGTACTTGGGGACTTCTAACTTTA
GAGTCTCGCGTCGACGCTTACGTGTCGATGCTGCAGTAGCAGACTGAGAATGTTGCTGTCTCATTAGCACAGTCTGCTGGTGACCGTGCTAATGCAGTAG
GGTCACTTCAGCTCGCGACGCGTCAAGTTCTCGTTGCAAGAACCAGGCAATTATAATATGTTGTTGGTCCCTATCCCTTGACGATAGAAGAGACCAGACA
GCTTCTTCGCCAACGGTCAAACTCATTCGTTCGACCGCACTCCATTCGATATTGCTCAATTAGGAGTAACTTCCACGGGTGCAGTGAAAGGTGTCGTCGC
CTTCGTCTTCCATCATGTTCATTTTGAACGCGTTTTGTGGCCCTTGGACGGACTACAAGTGCTATCAGGTGCAACGCACACCGGAGCAACACACTGGACA
ACCAATGTGGAGCTACTATCACCGACAGCAGCGTGAGTGGTGCCTCGCTACCTCTGTGCAAACGAGAAGAGGAAGGTAAACAACTAGGAACTGACTAGTT
TCTGGTAAAAAGTAAAACTGTATTAAATATAATTAAGTCCTAATCATTAACCTATGTCTTAGTCCTAGCTTAATTATACTCATCTACAAAAATGTATGCT
AAAGTCTTGCTCACCACTCATTGCGGGCGTCCATCGTTGATTGGACCGCTAGAGCTGGCTGATATGCTGGCCCATATCAGCCAATCGGTAAGTGTTTCTG
AATATTAACCCTTACGGTAATATTCACGAACATTATCAACCTTTATGATAATATTCGAATTAATATGTGTCAAGGGTTGATTATATGTAACAGGCTCACC
CCGTTACAGCTCCTGTATATTGTTTGCAACTTGATTCAGTTCTCTGAACTGAACTACTTATAATAATGGGCGAACTCCAGTGCTTGCTATTCTATTTTAT
ACACTAGCATTTGAGCATTTCTAGCAGTAAGAATAAGTTAAATTTCTGTCGAATTAAAAACGTTATGCTTTATACTCATGAAGGTGCGCTACAGCAGCGG
AATAAATTTGACAATAATTAAAAAATATATATTCTCGTTAGCTGGCCCACGCTTTCTAGCCCTGCAACATCCAAGATCACTTTTTGGATTGCATGTAAGT
AGGTCATGATATTTTTTAATCATCTTATTGCCTTATTGTGATTGCATGTATTTGGTGGGAAAACAAAAAAGCTAAGTAATTACGTACAATAAATAAGGAA
GGGTTAAACGCACTGGTCGATGGTGGGTCATTGCACCGGTGGTTTGTTTTGGCCAATTAAAATATGACATCTTAATTTTAATCTGTTATGGCCAATCGAA
TTATGACGATACCATCCCAGTTTTGATGGACCCACCAACATATAATTTATAATCTTATTTGCGGTGATTGCTATTGCTGGTAGGCGATGAGCTACGAAAG
CTGAGGAAATAGAGGAGACGTAGAAAGAAGATATTGTACGATCATTAATAGCCCATACATGTGGCCTTGTTGACGTGGTGACATTATTGAGTACACTGCA
CTTATTTCATGCGTACATACGCATGCTATATAACATTTATGTGTACCTGATGCTTCTATTATCAGTAGAACACTTTTAAGAGTCCAAAAAAATATTAAAG
AGTCGTCTGAGTATACCTGGTTTTTTCAACCCTCGACGTTAGTTGCCTTGAAATTTGCTTCATTGATAATTTTAGCGTCGTTGTTGCGTCATCATCGTGA
GTGGCGTTTTCGGTGATGTAGTTGTTGATATCCGCCTTAATAACCAAACCATGGTGTACTAAATCATGTTGTACGCTTTATGACCAGGTCTTTCAATGTT
GCCATCGGGAATGAATTTAACATGATCCTAATGTAGCTGTTTATGCAATAAAGAAGACATGATAACTAAATGGTATGCATATGTACGCATGAAACAAGTG
CAATGTGCCTATAGAGAAGGTGACTGCGTCAAAATAATCACTGTATACAGGCTTTACCAACGTATATTTAATCAATGTGCTTCCCATAATTTTGCTTTGG
TAGCTTATCGCCTTTGAGCATCCGAGATCACCGCAAATGAGAAAACATTAGGGTAGGTACATCGAAATTTGGGATGAAAAACGTGCCTTCATTACAAACA
CGTTAGTTCATCCGTCTTCTCCCAACAATACACTTTGCGCCTACTTATTGCCGTCATTTTTGGCTGCACCGCGAAGTTGACTGAAGCATCCAACTCGGCT
ACAGCGAGCACGGGTAAACGTGCACAATTAACGTCCGCGAGGACCACCAGCGTTACGGAAGCAAGAGTAAACGTGTGCTTCATCTCGAGATATTTCATAA
ATATAAGATAGGGGAGCAAGCTCTGGAGCTCGCCCTTTGATACAAGTAATTTATTTCGGAGAACTGAATCAAGTTGAAAAACACTATACAATAGCAGTCA
CTGGAGAATGAGTATGATGCACTTATTGTATGTATTAAAAACCAGTACAGTATACCCAAGGAACGCGATCAGCCTTCGCTTATGAGCATCCAGCATGTGC
TTATGTGATCATATTCAACTTTGATCGATTCTAAGCTAATCACAAGCGTGGATCACAATAGAGACATAACCAAATAGTGACTCCGAATATGCCTATATAC
CCATGAGGATGGACAGGCTAGATCGCACTTAGTACGTGTAAGGTACACCTATCCGCGTTATTTACAGACAGACCCACAGGTAAGTACGATTTAAAAATTC
GGCATTCAACCTTGCGCACAGTCACTCATAGCTTCACCCTACGGGCTCGCAATGAACCAAAGCTTTCCACAGTTATGTGGTGTGCTCAATCGCATTAAAC
CTCCATTGGCCCAGGCTATCGAGCGGCATTTGAAGAGACGATTTATATACTTGGGAGCCCATCACGCTGAAGTCTTCTCTCAACGCAACTGTGAAATCTG
CTTCGAAAGACACTGAAGGCTTCCACATCAATTACCAACGCTGGTTTCAGTGATCACTCCTGTGGCAAACTCTTGACATGCGTCACCGTATCGATATGGT
CCGTGACGATGTAGGACGCCCTTTTGTAATTTCATTGGACTTATTTTAGATGTAGAAAGCACCAAGTTTAATTTAAAAATGGACTGGCGACCCTGTCTCA
GCACCAGATATGCTTAGTCCAGATGAAGCCAATGAAGCACTAAAGCGAGAAGAGCATATCAAATCCGTACGAGCAATGGTGGCTATAATCTATCGCTCAG
AGGAAGTCGTCGGATCAATTCGAAACGTCATAGTATGAGCGTTGACGATGCCCCAAGAGAAAATACATTAAAAAAACGCTTGGCGTGAAGTCTACAAAGC
CGAAAATTTAGATATAAATTTTGAGGATTCAGGCCATAAGAAATATGTGACGGGGTTACATAAACGGTTGTGATAACCAGGTACGCAGGTGTGATACACA
AATAAAGAGATCAATAAGACTGATGGGCGTAGTAATGTATCACATACGCTAGCTGTAATACCGTACCTTATCGATTACGGATAGATGGTATCCATCGTAA
TAGGGTCTTTATAGTACGGCGTAGTTCTGGTGTGATAACACCAGAAGAACCCTCAGTAGGACTACTCGATTAGGTAGCATAGTTTCAAGGTTAAATACGC
AAGTGAGTTTTATTATAGCTATAAATCAGTAAATAAATTCAGCTCCCCTTTTTATCAATCTAAGACATTTGTCTTGCTAAGACGTCTTTGGTCGTAGGAG
TCAGTAGCCTGTACTAAGGCTAGTAATCTTGAGCATTAGTGCCGCGTCATTTCCTTGGAGTCGTTAGTCCCCTGGACCAGAACTAGGTGCTTGAAAGCTT
GTTTCGATTATTAGAGGTAAGTCTCAATAAGTCTGCGAAGTCTGGAGACCTTTTAAGTTAATACCCGCTTAGTTGAATAGTCTAAGAGACTCTACGAGTC
TATAAGTCTTCTTATGGCTAAGGTGTGAGGTTGCTCCTCGACACTTCGTAGCACTTGTAGTCAATCTACAACTGATTCTGGTAAAGACTGGTCCTCCGCA
AAGATGGAAACAAAGACAAACCTTTCCACGGCCCAACAACTAAAATTGGAGAAATCAGAGCGCTAGTCGGGAACGAACAAGTGGATCTAATCCTCGCACA
AGTTCCTGACTTCATTCGTACACACCTTGACGCTTTCATGCAGTTTGAGTCCACTTTAGTTGGGCAACTATACGACCATATGGCATCAGCTATGCCTACT
CGGTAAGACCCAATACCAGATGAAGCGCCGAGGGCTCCCCACTCTTCCTGAGTGTAAAGCCGTGTGAGGGAAAAGAAGGGGGAATCTCCTTCTGTGGATC
AGAGAGGTGGAAATGATCATGAACTCCACTATGCTCCAATCGAAGCAACATCGAGTTGGGCTGGATATCTCGAAACTAGGTGGTCAGACCAGAGAATGGG
ATCTAACCTGTATTACGTCTGTGGACGAGGCTTTCCCCCATGGGATTTGCTGAAATAACAAAAATCTCGAGTGTTTGCTCCGCCTAATCAGGCATTTTGC
ATGCGTTCTTGCTTTCTATCTGCCCGCCAGGGCAGGAAAGAACTATCGGACTATGTCCAGGAGCTGAGAATTTTAATTAATGTTATGCAGCTTGATCCCT
CCCCAGAAATGGTTCTGGTTACCATTATCGTGGAGGGTCTTCGTGCTGGCACGACTCGAACGAAGTATTCCAAGTACACCACGCCTCGTTTGAGGCGGCT
GTTGATGTTGCGCTGATCGCTGAGTCTAACTTTAAAGACGACCGCTTGGGCTTAACCCAAACTCGTCGAACTCATTTGTTCATCCAATATAAGCTGGAGT
CTATGGACCTTTGTCTCGCCGAGACGGATGAAGAAGCAGAGCTTCGAGCTGTAGAAGAACATCGTAATACTCGGCGATATTTCACGTGCGGAAGCATAAA
GCATCTGCACCCTGATTGTCCTCTAGTTAAGACAGGTCAGGATTCTTCGAGCCGAACCCCTGTTGTCTGGTACGACGCGGGAAAACGTAGGCTTCCAGAA
GGCTCGGGGCGCCCTTCTAGAGAAAAACCAGGTTATGTTGAGCCTTTAGGAGGTAGTGGCGAATAGAACTTAGCCCCAAAGAGTTCCTTGCACTCTAACA
CGGACGACAGTAACACTAGTGACACTTGCACAATCGATTCAAATGAGGTGCGTCATTTCACTATTGGACAGTAGTTACACAAGGAAGACAGAGCACGTAT
TGCATATGCACCCCGAAAACCCCCCATGGGCCCCGGGGGGTGGGGGTCTGGGGGGTGCCCTCAATCCCCCAAAAAAACCCGGGTAGGAGCCGTACTTGCT
CCCCTGTCTTACCTTTAAGATCATTTTCAATTTGACATCATCATTTACGTCAATGTCTAACAAGGGCCATCCATTCCACAACTTTGTCGACATGGAGGTG
TCAGATCTTTGCCTCTCGCGAATTTACTTTCGTAGATCGAAGATACTCTGTCAATGGCCGATAATCGAGCTGTGCGAACATTTAGCATACGCTTGGACGG
CAAAAGTTGTGTTCAGTTCAACGTAGACGTAATGTATCAAGTGAATGTCTATCCGCCGTCTACAATGCTCAGAACTGATCGTCCTCAGACACATCAATAG
CCCGGCTGCAGATATTTATTTGCCCCTACTTCTCACTCTGACGGTCTAACGAAATCGCGAGGGGCCACTTTCTTAGCCTCAATCACCGCAATGAGGTCCA
TTAGCTTTTCATTTATCTCGCCGATCGACTTTTTCAGCACTTTCAATTCGACACTAGTCTCGAATGTGAGCACCGGCCAGGCCTGATCGAATTCCTCGCG
CATCTTTCGCAAGTGACGTCTCTGCGACTGGTGTCTCAGCAGCACCCTAGTCAATTCACTCGCCTTCGAAGCCGCCTTCGACCACGTGCGAGCCGTCCAG
TTAGTGATGCTCTTTGTCATGGTGCTCAACCACTCCGGTACCGACTGAAGCCGATTTAGCGCTCTTTCTTCATCAGCCGCACCCTTCGTGTCTTCCTTTG
ATTGAAGCGCCCGTTTGCCGCTCACGGTCGACTCAGTAGCCTTGTCTTGGACCGATGTTGCGCTTTGTGGCAGCGTGCCGGCTGCGCGAGCTGGCAGAGC
GTCACTGACAGCAATTGCGACGAGGAAGGGCACGAGAAGTAGGGAGCACTTGGTCATAGTGGAGGCCAATACTCGTTGTCGGTGGGTGGAGATGAACGGG
GTCCTAATTGGTTTGGCGCACACCGAGTGAATTTGATACTGACGTTGACTTGAAACCTCGAGAGAAGGCGAGTCTGGTCGCCACGTATCGAACCGAGACT
TCGCGCGACGTGCGTGTCCCGTGGCGGGAGAGACCTGGTCCTGCCGTGTCTCTCCCGCCACGGGACACGGCTGGACCAGTCCACCAAAATTTGCTAAATC
ATACTAACTTGCAGATCAATGCAACCAGGAATCAAATAGAGACTATACTGGACCGTCTAATTACACAAAAAGGCTATTTGACCGTGATCAGAATCCGCTG
AAAAACGGTAAAATGCCTCAGAGGCTGGCTAGAAAACCGGCTATAACTGAAGTTCTGTAGGAAAAAAAGTTTGTAGTCAGACATTGAAAGGTTACCTCTT
CTGCCCTCGTTCTCTCAGAGACATGATATGCCACAGAACAGGGAAAGCAGCACTATACATCTCATCGAGGGGCTGGTCTAAACATCCTCCTTCGATAATA
ACCACTCCTCTCTCGTATTTTCAGTACACAATTGTACATTTAAAGTGCTTTTGAGTCATGCTCTGTGATACCGCTCATCGTCCAGACACAAAAAACATTG
TGCCTGCGTGAGGTAATCGCCATGCATCACGATACACCATTCATGATAAATCTTATCATTTTTTTCACGATCGTGCGAGTGCTCTGTCAACAGGTTGGTC
TCGTACAGATTCCTAGCACAGCAGCACAGTCTCCATTTGCGATATAACGCACCTTGTGAATGAACAAAGGGATGACGGCGCACGACTTTGCGTTGTAGTA
TCTTTTCGACCTGCGGATGCTGGGAGCAAAAGATAAGAGCTACTACTTTACTTCTTTGTCTGAGCGAGAAAAAGCGCTATCGATTATTGCATGGACCTTA
CTACTGAAGCTGTCAGAGGTAATATCATCACGTGTATCCTGACAAAGTGATGAGCAGAGGTGACTGCATAAAGTACATTAACCAGTTTTAGTACACGTTA
TCGCAGGGGCAAATAGTTTGCGTCCATTTACTCTACTGCTCTCGAGCCCCCGTGCCCGTCGAAAACTGCGTTGATTTGGATATCAGCATCCTTCATCCAT
ACAATGTTCAGGCTATGGTCTTCACTCTGACTGTTGGTCTGGACCGAAAACATGCTCAGCACAGCAGTCGTTTGTGTCTCATTCGCGGCCATACCACCAT
ACCTGGAACTTAGATGTGCAATGACTCGATACGACACGATTTGGAGTATCTGTATCAATACCCGCAACTCATTGACGCTTTCTCGCTACTTGTCTGCTGC
CAACACCACAGCTATCTGACCCAGTTTTAAGGCCGAAGCCGACAGCAGTCACAGTCGCAGCTACATACCACGACCACGTCCCACAAGCGTCAATTGGTCA
CTTGTGTTCAATACATTTGTATTCTATGCGACGACAAAATCATGCCTACGATATTACATCCTAACTTCGACAGTGCTTCTCCCGCCGCCAAAATGCTTTA
CACGCAGCGCTAAACTCTATCGTTAAAGCTGTATCATGACACATGACAATGACCCTCACGCAAGTACAGTGTGTTTTGTGTTTGGCCGATGAGTGAGATC
GCAGAGCACGACTCAAAAGCACCATTTATGTACAGTTGTGTGGAGGATACAAGAGAGGGGAGGTAGTCTATCGGAGGAGGATGTTTAGACCTGCCTTTCA
TCGAGGCATCCCGCGCGAGAATGTCATCTGGTCGGTCGTGAGGATGGGAAAAACAACTGTCAGGAATCAGATGTCCGTTTTAAGAGATTCATGACTGTCT
ATTACCCATTATTATCACGCGTTAGAAGTCTGAATCGTCTAAGCCAGGAATCCAGCGCCTGACGCGGCGGTGGTTCGTGGCACCTTTCTATAGGTAGTGA
TTCGTCACTTCAAAAAACAAAATACATCTAAAGTATAACGTTCAAGGCAGGCATGTAGCTGAGCCCCCTGAACCATTGTTTCTGCGCCTCTGTGTACTCG
CATAGCCAAAGCGAATAACTCAGACGTCCATGTCCTACGGGACGGTCCAAACTCAACTTCAATAGACTATCTCTCCTCTTGTATCCTGCGGTACACAATC
GTACAAAAATAGTGCTTTGGAGTCGTGCTCTGCGATCTCACTCTTCGGTGAAACACAAATGTCGTTGTGTCTGCGTGAGGTAATCGTCATGCGTCATGAC
ACACACAATTAATCATAGAGTTTAGTCTTGCGTGAAAAGCATTTTGGCGACGAGAGAAGCACTTTCGAGGTTGGGCTGGGATGTCGCAGGCGTGGGTATG
GCGTCGAGTAGAATACTAATGTATTGAACTGCTTAAGCTTGGCACAAGTGACCTATTGTTGCTTGTGGGACGTGAGTCGTAGTGTGAAGCTGCGACCGTC
GTTGCTGTCGGACGTTGGCTTCAGTAGAGGGTCAGATAGGTGTGGTGTTGGCAACGGACAAGTAGCGAGGAAGTGTCAACATATTGCGGATATTGATACA
GATACTCCAGCTCATGTTAGTTTTAGGCCATTGCACGTCTGAACACCAGGTATGATGGTATGGCCGGTGATGAAACAATGTACTGCTGTGCCGAGCATCT
TCTCGATCGAAACCAACAGGCCGAGCGAAGACCATAGTGAACGTTGTATAGACGACGGATGCTGGTATTCAGATCAACGCGGTTTCGACGGGCACGGCGG
CTCGAGAGCAGTAGAGTAAGTGGACGCAAACTATTTGCCCTGCGATAATGTGTACTAAAAAGGGTCAATGTACTTTGTGCAGTCACCTCTGTTCATCACT
TTGTCAGGATACACGTGATGATATTACCTCTGACAGCTTCAGTAGTGAGGTCCATGAAATAGTCAAGAGCACTTTTTCTTACTGACATAGAAATAAAGCA
TTCGCTCTTAGCTTTCATTACCAGCATCCACATGTCGAAGGGCTACTGCAACGCTAAGTCGTGCCCCGTTATCGCGTTGTTCATTCATAAGGTGCTTTAT
GTCGCAAATATGGGAGACAGTGCTGCTGTGCTAAGAAAAGAAAACAAGAAGACTCCAGAACTACAGGCGATCGAATTATAAGCTAATCATTATTACTGCG
ATGATTCGCACGAGACCAAGCTAGTGATCGAGCACTTGCACGATCGCAACTCTAAACTTTATCATTAATGGGTACTATCACGCATGACGTTCACCTCACG
CAGACAATGATTTTTGTGTATGGGCGATGAGTGGGATCGCAGAGCACGACTCAAAAGCGCTATTTATGTACAAATTCGTGTACTGGAAAATACAAGAGAG
GAGAGGTAGTCGATTAAAAAGAATGTTCAGACCGTCCCATGTTCTACTCGGTGCACGCGTAGCATGATTGGATGTCAACGGGGAGATGCTTGACGGCAGA
AGCTGACAGACGAGCTAGCAGATACTGTAGAAGCTACTACACAAATGGCTAAAGTCTTACCTTTCTGGTGTTTTATGCACGTCGATTGACCAAAGATGGT
CAAATTGTGGCAGCTTCATCAATTATATGTATTTTAAAATAGTTAAACTAAGATTTACTCAAACTAAAAAGAATAGAAAACAACGATGAAAAAAGCTTAA
CTCGCAATGCCTCATCCACAAATGCATCGACCTGACAGTTGCACACCCACAGGCTTTAAGGGAGCGAGAGCAGCGTGTCTTCGCTCTTCAATCAACCTAC
CGAATCAAGACAACCACGTACGCCATGAAAACGACACTGGAGTCTGCATCAGTGGCGCAGCTTGGGGAAAAATCGGACGTGTCTAATGGTGCAGACGAAG
ATTGTGATTGTGCTGTCCAGGACGGGTTGTCTATGGAAAATGTAGTGTCGGTTGCTCGATCGGCACGGGTCACAAATTGGCAAGGACCTCGTATCCTATG
ATCAACAAGGCACTGTGGCAAAGACACGCTCCGGTTTTCGTGGAAGAATGTCTTGAGTCAAGCGACAAGCTTGACGTGGGTCTTAAGAGCGCGAAGAATC
GAGTGTGATTAGGTTGAGCAGACGGAGCAGAAGTATGGAAGGGTACCTACATGGATACAAAAGCTGGCTGCAATGCAAGCTGTAATCTGGATGTATAGTT
GCAGCCTCGCGACGACGAGACGGGAAGGATGGATAAAAAGTGCGGCTAGCAGTTCAAGACGTGAAAATGGTGGTTCTTCGTGCAGCGAAAGGACGGCATG
CTGTCGTATTGAGTGGAAGAAGCCATTGACGTCAGCGGTGGGTCCGATGCGGACGTGTCAGTGCAGTCCAATTCTATGGACAAAGTCTTAGTGTTCCTCA
TTGCCACGTCACAGCGGCACCTCATGATCTTGGTACCGTCACAGCCCGTGATGAAAATGTGAATTACCCGACTACATGCAGTTGGAGTAGTTCTTTCCGA
TCTATGGGATCCGCTTCACGAGACGGTGAAGATTTACGTGCATGAAACAAAAATAAACCACGAATGGGAGCACTGTGAAGACCCTACATCGCAGCGAGAC
GACTGGTAGGTCGGCGTATGACGCCCGGTATCTGCTGTGCTTCCCACGCCGTGTGGCGGTGATGCGTCTTTTGTTGTTGTCGCCACTGCTGCGGCTGCGA
CTAACATCAAACAAAGACAATCACAAATGCAATGGAACAACGAATGAGTTGAAATAATTATGATCATGGTCGTGTATTCGTGGTCGTCGTTGTTTTTATT
TTCGTTTTGATGGTCCATTTGGCCGCGTCATCCTGTTTGTCGTCATATTCGATGTATTTGTGGTCGTGGTCGTCGTTGGCTTTGTTTTTGTCTTGATTGT
CCTTTTTGCCAGCGTCATCTTGGAGGTTGTTCTTGTTGATGTTGTAAGCCTCATCGCCATTTGCGTCCCCGTTCAATCTCCGTTGCCATGTTAAAGTCCT
TCCAAACATCATCCGCATTTTCCTCTGCATATACATCCACTTCTTCGGCTTCATTTTGTCAATTCCTATACCTGAGTTTGTATTTGAGTCTCCTCCTACC
CTGTCGGTCATATTGCCGCATAGCGGAGTGGTATTACGGTAAGATGGCAGGCTCATCCCTGCAGCTTATATCCAATAGAAGGTTCTGATAATCAACATAG
CAAACAATGCATCAGTCAAGGAATTCCAACGATAAAAAGACCAAACACAGGTCCGTACAAGACAGTAGAAGAACAAATTTGAATTACACTTGGTCGCGAT
TGCTCAATGTTGTTAATGTCTATTCAATTACAGCTAAAGACCACTATCAGGACTTGATGAGTGGAGAGTGTGGCGGAGATAGATAGATCAAATATATATT
TAAATTTTACAGCCGCCTCAACTATTGACCATCTTTGGTCGATCGACGCGCATAAAACACCAGAAAGGTAAGACTTTAGCTATTTGTGTAGCAGCTGCTA
TAGTATCTGCAAGCTAGTCTGTCAGTTTCTGCCGTCAAGCCTCTTCCATGTCGACGGGACCTAAAGATTGGCAGCCTATACGTTTTAGTTTCGCTTCAGT
TGATTAAAGATCACGAGTCATGTATACATTACCGACAAAATCTCTTGATAGGGAGAGGCTAAACCGCAGTAGGTTAAATACCACCCAGATGCGACTCGAG
TCAGACTTTTCTATCCTTAAGTGGGAGATGAACCCCAACCGCACTTCCCCGATGCACCTGTCGCTCGAGGGCATCTTCCAGACGAAGCAGCGCGCCCTTC
TCGAGCAGTTATCGCACCAATAATCGCCGACTTATGCAAATTCATAAATTAGTAGTGACGTAATCAATAAACTAGCTTAGTTTACATAGTTCATGGATTT
CCATATCTTTATGAGGCCTGTAGTAGAGCCTCCAGCCTACCTAACTATCACACCCGACAGTGCAGGTTGCCAGGACTGGCAACCATCATATAGTGACTCA
CCTCCACTACTAGCCCATGAACGATGCGAAACATACGCCTCCGCGGATAGATATCGGTACATCTCAGACATAGTGCCACGGGTGATTACCCGGCCACTGA
GGACGAATCTTAGAGCTTTACAACTTTAGCATCGTATGCAACCGCAATTTAAATTATATCCTTTACAAATCAGCGCTTTAACTCGTACTCATAGTGTCTT
TCTAATCAAGCACTGCGGGGACAAAAGCAAGACCACATATCGGCACATAAGATGATGGTATTGTTATATTCGCTGTCGCAATTTTAGCCGAACGGCCACC
TCCTGTTCGTGTCTTTCCTTTTGACGCTGCTGTGGCAAGTATAAATCCGCGACCCTTTGATTTAGCTCAATGTTGTAGGCCTTGACACACGCTTGCAGGC
TCCAATTGTTCATATAACGGTTAAATGCCACCAAGTGCCCTGTTAACTCCAAAGTCTCGTGCGTATATCTGCGATCCTGAGTCTGGTGGCCCGAATTGCG
TACATCACACAGCTCCGTCCGCATGGCCTCATCAAACAGTACAAACAAACGATCACCGTCGACGTTCAGAGCAGCAACCGTTGAATCGCCTTCTCTTTGT
TCATCTTCCAGCTCTTGTAACGCATCAGCCAGCGCTCGCCCAAGTAGTGTCTGCCGGTACCCGTCCATCACAATGTTTTCAGTCGACAAAAATTTGGAAA
TAGGCGACCCAGTCCTACTTTTTCACTTATCTTTGAAATCTTTCGTTTTTATACAAAACAATTTCTAAACCCATCAGTGATCGGCCAATCAGCGATCGTT
ATCTTCAGACAACCACGTCCACCAGCAGCTCACAATGGCGCTGCGGGACGAGCACGATTTCTTAAGCGAGAACGAGCGCCAGTTTCTGGCTAACTGCCTG
CGCCAGCCGCCGCATATACGAGCTAATGGTCGAGAGCTGCTGCAGCAACGTAAGATTCGGCTGCAGTTTCGTCGCAGCGAGAGTGCGAGCCAAGCCGAAG
TTCAGCTCGGTCGGACTCGGTACACAAGCGCTTATCAGTAATTTCTTATTTCTAATGCTCTTGCACTCACTTTGACGCTAATATCGGTCTGTTGTCTATG
TCACTGGTGAACAGAGTTATTGGCAATGTATATGGCGAGATCGTGCCGCCCTTTCCAGACCGCCCGACCGAAGGCTTTCTTCATTTCTCCGTAGAGTTGT
CGCCAATGGCGTCGCCCAGTTTTGGGGCATCGGCGTCGGCGGGTC