Description :
From Genome Similarity Track
Location :
Scaffold_209:14913- 33928
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_209-fgenesh-gene-0.1Tetratricopeptide repeat protein
Pytve_DAOMBR484maker-pve_contig_209-fgenesh-gene-0.2Histone-lysine N-methyltransferase
Pytve_DAOMBR484maker-pve_contig_209-fgenesh-gene-0.7Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_209-snap-gene-0.22Oxidation resistance protein (ISS)
Pytve_DAOMBR484maker-pve_contig_209-snap-gene-0.23Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_209-snap-gene-0.16Ser/thr kinase
Pytve_DAOMBR484maker-pve_contig_209-snap-gene-0.17Ribosome protein L26
Pytve_DAOMBR484maker-pve_contig_209-fgenesh-gene-0.9Calmodulin binding protein

Sequence
19015 bases(100 bases per row)
TCAGCTCGGGTTGCTAAAGCAATGGCGGACGCGGACTTGCTGGAGGAACTGTGCGGCGTGAGCGAGTCCACGATGGGGCTCTCGGTCGAAGACGACCGCG
TTGTGCTGCTGGACGCCTTCTCGGCGCTGGAGCGCGGCGTCATCGAGACGGACGCGGCGCAAGTTGAGGCGGCGCGGCGGCAGCTGCTCAACCCAGGAAG
CGATGCCATCGCCAGCGCAGTCGACATGGCCAAGCTCATCTGCGAAGGGCTTTACGCTGACGTGTTGCGCACGCCTGGCTGCAGAAAGCTGGTGGCGACC
ATCACCGAGCGGAGCGAGCAGAGCGACGAGCATATTGCATCGGCCATCACGCGATGCTTGGAGGAAGTCGTGTTGCAACACGCGACGTTCGAAGACCGGA
TCGCCGCCGCGTACCAAGTACTCTTCGCGGGCGTTGCCTTCTTCAACATGTATGTGCAGGCGAACTACACTGGTCCCGCGTTCGAGCCGGAGCAGATCGT
GGACGTGCTGGCGCTGACCGCGAAGATCCTCAAGCCTGAGTCGGACAGCGAGGCGTTCCAAGGGAAGCAGGTGCACGTGGACGCACTGGTGAGCCTGCAG
GTGGACGGCGAGAGTCCGTTCTCGATCTGCGAGTACCCGCAGTTCCTGCTGGTGGGTCGCTGCTTGCTGCAGTTCGTTGGCAACTACACGCACTCAAACT
GGTCGGTCGCGATCACCGCGGTGGACAACGACGGCGAGTCGTCGGATGTCGCTGCGATTGAAGTCAACAGCGAGATCAAGGCGGTTGTCGAGGCGTTGTC
GGCGTCCAAGTGGTGGAATGCACGAGCTGCCGTCGCGCATGGTCGTCTGCTTCTCTCCGTGGAGCCGTCCAACACGCTCTGGTTCGAGTCTCGACGGGGC
TACCTCGCAACCATTCACAGTTCCGAGCTGTTCGCGTTCAAGGGATCGGAGTACCTTCGTGCGCGCGCGTATGTCGAATGGGGACTGGCGCAGCACCACT
TCGACAAGAACCGGCGCGGCAAGCGGACGTTTGAGGAAGCCAAGACCATCAGTGGGATCTCCGTGCAGCTCAGCGGGTCGATGGGCAAGCGCACCAAGTT
TCAGCAGAAGAGCGTGGCTCAGATGGTGCTGCTGGCAGCATCTAAGCGTGTGCCCGACGATGTGAAAACGTCCGTGTACGCAGAGGCTGTGGCCGATGCC
ACTCACACCGACTTTGGCGGCAAGAAGGTGGAGACCGAGAATGGAGAGAGCGTCAACGCAGACGGTCTCACGAAGGAGGAGCAGCAGATCCAGCAGCTCG
TTCAGGATGGAGACGCCTCGTACCGGAACGTGCACCTCGACCAAGTCGACTCTGACAACATTCTGCTCGAGAACATTGCGTTCGAGGACAAGCGCTTGAC
GCACCAGGGGAACCTCCAAGTGGTGGACCAGGTCGTGCTGCTCGCATTGTGCCTGGATGTCAAGAACAGCAACGCCAACGATGGGCTCACGCGCGAAGAG
ATGTTCCCGTACATCACTCGCGTGCTCGAGAACCCGAACAACTGGATGGTCTACTCGACTGGCTTGCTCGAGCGTGCCTGGCTCGAGTGCGAGACGTCCA
AGCGCCGCGAGCGCGCCGTGCTGCAAATGCAGGCGCTCGTTGACCAGCACACAACGCGGCTTACGATCACACAGAACACTTTGCAAGCCATTGCTGACTC
GGCGCCGGCTCATGAGCGCATGCAGTTCGTGCATGCACTCGCGTTCCCGCCTCGGTACGCACTGAAGCGCGACTTGGCCGACCGGTACCTCGCTCTCGGT
GTTGTGGGCAGTGCCGTCGAAGTCTTCGAGGAGCTCGAGGTGTGGGACGATGTTGTCAAGTGCTACCAGATCCTGGACAAGCCGACGCGGGCCGAGAAGG
TGGTGCGTGAGCGGTTGGAGGTCGCGCCGACGCCGTACATGTGGTGCTGTCTCGGCGACTTGACGGGCGACATCTCCCACTTCGAGACGTCGTGGGAGTT
CTCGAAGCACCGGTTTGCTCGCGCCAAGCGGTCTCTGGGTCGACACTTTTTCGAAAAGGGCGACTACGAGACGGCGATCGGCCACTACCAGGACAGCGTC
AATGTGAACCCGATGAACACTGGCGCGTGGTTCACGCTTGGCGCCATGGCGATGCGTTCGGACCAATGGGACCTGGGTCTGCGCTCATTCACGCGTGTCG
TCCAGCTCGAGCCTGACAACGGCGAAGCCTGGGGCAACATCGGCTCGATCCAGATGCGCAACAACCGGTTCGCCGAGGCGTTTTCGGTGCTGAACGAGGC
GCTGAAGCAGAAGCGCCACATGTGGCAAATGTGGGAGAACTACGCGCTGTGCGCCATGGAGACCGAGAAGTACGGCGAGGCCATGTACGCGATGCACCAG
CTGCTCGACATGCGCGCCAAGCATAAGCGCGCAGTCGACACGCAGATCCTCGCGTGGCTCGTCGAGGCGATCGTGTTCCCCGAGTCGCTCGCCAAGATGC
TCGACGATGAAGGCGAGGCGGCCGCGGAGCAGGCTGCTGATGCCAGCTCTTCGGCTGCGATCGCCGGTCTCGACGACAGCGACGACGAAGCGGAAGACCT
CTCGCAGCTCGATGAAGCGGCGATTGCCACCGATGCGACGCCGCCGCGATCCAACTCGCAGTACAAGAAGCAGCTGGCAATGCTGTTCGGCCGCATCACG
TCCATCACGACCAACAACGCGCGCGTCTGGCAGCTCTACGCGCACTTCAACGACGGTCTCGACCGCAAGGAGAAGGCTCGCGAGTGCCGTCTGAAGCAGT
GTCGCGCGCTGCAGGTCGCCGGATGGGAGACGGACAAGACGCAGGTCCAAGATCTGTGCAAGGCTGCTGTTCGCCTCTCGCAGGACTACATCGAGGAAGG
CACCAAGAAGGCGCTGTACTCGTGCCGCCTGTACATCCGTGGCGTGCTGAAGAAGGCCCAAGTGGACTACGCCGACCTGGAGGCCACCCAGGCACTTGCG
GCCACGCTCGACAAGGTCAACGAGCTGGAGGCGCAGCTGTAGAGAGCTTGTGATCTCGAGTCACGAGCGCATTTGCAGAGTGTCAATCTGAGGAGGACCT
TCGACGACACTTTGCTGGGAATGCACTCTTGATGGTTGGAGTGGTCTCCACGTACCATATCTGGCCTTCCTTCGCTGTCGTTGACAGCGATCTCGATCCA
GTGGAGCATCCGGCTCAACATGGTGTTTAGGATGTGATCAACTTGAGCATCAACATTTTCATTCAGTGGAGCAAAAGGCACTTGGGCGGAAAAGAGGACA
AACCCTGCAAAGTATTGTGGCGAGCTTTCGTCATTATTTCCGCCAATCCCGTCCCGCGTACCGAAATTCTCGCCAATCAAACGCCAGTATATCCCCACTT
TTGTTTGAAAGGCTTGCCGATTTGGCGCCGCTTTTTTCGCGCCTAGCCGCATTCAGTCAGTGACTTGCTCAGCGTTCTCCACCGCACCGCACCGGGCAGA
ACTTGCGGCAGACAATGGCACCCGGTCGACAGCGCAAGGGTGGGGCATCACTGCCGCCGCGAGAGGCAGCGCGGCCGACGCGCCGGGCTGCGGTAGTGGC
TCGCTCCAGCGTCGCAGTGCTGGGCCGCCGCCGGCCGTACAAGCGCCGCAACCAGGCGGTGGTCGAGGCGGAGGACAACAAAATCGGTCGCCGTGCGACG
CGCGCCAAGAAGCGCAAACTCGAGGAGCTGGGGATCGCTTCTCCAGCGGTCGCGGCAGCTGTAAAGGGCGAGGTCGCCATTGCGGAGGCGCCGAAAGCGA
GCGAGCAACCAGCGGAACAACCCAACGAAGCGATTGTGGATGAGGCGTCGCCGCTGGACCGCGACACACAGCTCTTCCTGCACGCGCTGACCCAAGACGA
CCGGCTGAGCGAGGAGAAGCACGGACGCAGGTCTATCGCCAGGCGTTTTTCGTTCGAGCTGCCCTTCTCCAAGCCCGAGATCGAGCATATCGAGGTGCGT
GCGACAGCCGAGGAGGTACAAATGGTAATTGGGTGGTTTTACTGACTGGTGGTGGTGCAGGCGCGACGCCTCAAGCTGCGGCCGCCTGTGTACGGACGCA
TCTGCAAGAGCGTGTACGTGTCCAACAAGATCCCGACGGCCGACTTGCCCGTGCACAAATGCACGTGCTTTACGGACAAGCCGGCGAGTGCGACGACCAA
GCGTGCGACGCAGCTCGCGAGCGCCAAGGCTTTGCTGGTGGGCGACGCCGAGACCGTAAAGCCGACCCGCCGTCTCAAGGGGGCTCGCCAGTCGGAGCCG
GACGCCGAGCCGTCGCCGCAGTACTGCGGGGAGAACTGCTACAACCGCATGATGTTCATCAGCTGCTCGAACGAGACGTGCTCGGCGCCGGACCCGAGCC
TGTGCAGCAACCGCGCCATCAAGCGCCGAGAAGTCAAGTACGGTGTCAGTTTGTCATGCCTTGCATCAATGCTGTCGACTTATGCTTTGCTATGTGCCCA
GACCTGTGCGCGTCGAGTTCATCCCTGGTCCAGGGTTCGGCTTGATCGCGGACGAGGCGATCCAAGCCGGCGAGTTTGTCATCGAGTACGTCGGAGAAGT
CATCGATGACGCGGAATGCGAGCGTCGCCTCATCAAATATCGTGACGCTGGAGAGGTACGGAAACGCCCGCAGTTCTCCTGGTGGATGCGGGACTGGATC
TAACCTGCTGTGCTTCATTAGACACATTTCTACATGTTGGAACTAGAGAAGGACGTCGTGATCGACGCGCGCTACCGCAGCAACGAGTCGCGCTTCATCA
ACCACAGCTGCGATCCTAACAGCGTCACACAGAAGTGGTAGGGCTGGTGATACTCTTGTGTCTGACCTCTCGCGAAGGCTTGACTCATGCCTCGCTGATG
TGCTCTTGTGCTCTGCTCAGGAACGTCAACGGAATCCAGCGCGTCGGTATCTTCGCGCGCCGCAACATCTCGCCGGACGAGGAGATCACGATCGACTACA
ACTTTTCCCATTTCGGCGAGGCCGTCGACTGCAAGTGTGGCTCGACCGCGTGCAGAGGCAAGATCGGTCGCAAGCGCTCGGAGATGCCCAATCTTCTCCC
TGCTATCGCCGCGGCCATGCAAGGCAACTCGAGGAAGCGCATTGATCCCCTCGACAAGCCGATACCCGAGCTCAAGCGGCCCGTTCCGGTGTCATCCCTG
GCCCTGTTGAAGTCTGCACAGGTATGTCGTACGATTGCTAGCTCAGGGAGTGTGTGCTGAGGTCTCATGTCTTTCTTTATGCTACAGCTTGATCGCGCGT
GGCTGCACCTGTACGGTTTCAACAAGCGCCGTCTCTTCTTCAGCCATCTGGAGAAGCACCTGGCCGTGGTCGGGCCGAGCGAGAGCAAACCTAAAGAGGA
CGTCAACAGCAGCAAGAAGTCATCTTTGGCTCCCTCCTCCTCGACCAGCAGTCCCGTGTCGGAGCAGTGGTCCACGACCACCGAGGAGGACGCGCATACG
TCGTCCGCATCTTCGACGACAAGCTCAGCGGCGGCATCTGTCACCTCGAAAGATAAGCGCAACTGGTACGAGCGGGTGATGCAGGGCGAACACTTGGAGG
AGATGCGCAATGTGCACAGCTACATTTGCGGCGGCAAGTCCGACTGGACCAAGGATCTGGCCAGCAAGCGTTCCGGTCGTCCGCCAAAGAACAAGCTGGC
GCTGCAACCTCGATCAAAGCAGCAGAAGCTGATCCGCAAGCGCCTGAGCTTGCTGGAAGCGCGCGCTCGCTGTGTCTCTGGTTCGTTGTGTTGTGTGGCG
ACAGTGTTTTTTTGAGCGATGAACCAGGACTAATCGGTGTGTCGATGACTACAGACATTGTCGCGTTCGCCGAGGGCAAATCCAAGTGGAACGCGCGCTA
CCCGGCTTCCCAAATGGATCCGGACCGCATCTTCCGCTTCAGCAAGCACATCAACGACGCTCAGATCTTTTTCAACCCCGATCAGGTATTGCACAATCGT
CTGCAACATTCCGTCGCATCGCACTCGATCTCTTTGGACTGAGCCTTTGTCGCTTGCAGAACGACCTGAACGAAGACGCGTGCTACCGCTGCGGCCTCGC
GGGCGAGCTCATCTGCTGCGATGGCTGTCCTGCCGCCTTCCATCTGTGGTACGACCCATCTCGCTTTGTTTGTCCCAATGTGGTTTATGTAGCTTGCTGA
CCGCCTGCCTGCTCGCCATTGCAGCTGCACCAACCTGGTGAGCGTCCCGCCCGCCGCCGTACCGTGGTTCTGCTCCGAGTGCACCAAGCCCAAGCAGGCC
AAGAGCGACCTAGACGCGGCCAACTCGGTCGAGCTCGGTGTCGGCGAGCGCCGCCNNNNNNNNNNGCGCCGCTGGTGCCGAGCCTCAAGAAGATCTTCCA
CTCGCGCACGCCGTCCTCCGAGCTGGGCAAGCGTCGCTACAAGAAGCGCGCGCGCGCGTCCGACCGCTCGTACCGGCAGCTCGAGCAGCNNNNNNNNNNT
GCCGTCCTGGAACGAGTCAGACAGCGACTCGTAGAGGCGAGTGAGCCCTCGCCCTCCGATGCAGGGCGTGTCGCTGTCGACCACCTTTGTCCACTCGCTT
CTGAATGGTCCCATGAGGTGTGAAGTTGTCGATAGAACGCGGTAAATACACGGATTCTCCGCTGATCGATTGATATCTGCTATCTACTCGTAGAGCTTGG
CTGGCACTGGCCCCTCGACCCGGTCCTTCAAGAACGCCTCGCTGTCCTCCTTTGCTCGCTGTCCCATACACACACACATGCAGTATAACACTCAGTTCGA
TAGTCGAGCACCTCCAATTGTCTGTCAATGTTTGCCATTGCCATTGCCGCACCTTGATGGCCGTGACGAGCGCCGCGTAAGGACCGTCGTTCTTGAGCTG
CGGCAGCGCCACGCCGCCGTCCATCTTGCCGCCGAACGCGTGGTTAGTCTTCTCCTCGCCCGCCGCCGTCGCGTACTCGTTCGAGGCCTCGGCCGCGCTC
GGGAAGCTCTCGAACGCGTGCACGTCCTCGCCGGCGAAGCGGTAGGTCGCCTTGAGACCGGCGCCACTCATGTTCGCTTTTTGTTGTTGATTTCTGACAT
TTTTCTTCAATTGAGCCACCAAACAGCAGAATCCCAAAATAACGATTTCTGCATTTTCAGAGGTAGAATAGTGATTTTCATCGGGTTGAAAAAAGAATAA
TGCAAGCATCTGGCAGATTACCTTATTTTTTGCATTTTGTATCGAGCGAGTTTTGTGCAGTTTTCTGGGTCTCGACAAAATGGACGCAGGCGGACTGCGG
CTGCTCAAGGTGCTGCACCGCGCGTCGGGCGTGTGCGTCTTCTCGCGGCGCTGGAAGTGGCATCCGCACGCGCACGAGGAAGGCGTGGACGCGCTCGTGC
TGTCCTTCACGCAGTTCGCGCGCGAGATCGACGGCGGCAGTGCGTCCAATCGAGTCATCTCGGCTCATGATGATGTTGATGAACTAATGCGTCGTTCGCT
GCACGCAGATGTCGTGCAGGTGCATTTCGACTCGGGAGCGGGCGGAGGCGTCGACGACAAGCGGAACGCCGACCGTCGGCCGAGCAGTGGGCCGCTGCAG
TTCTCGGTGGGTGGCGCTGTGGGTTGGCGGAGCGATCGGTCGGCCACCTTGAATAACGCATTTGCTGCATCGCCACCAGGCACCGCAGGGTGGGCTCACC
ATGAGCGCCGTGCAGGATGAGCGCGTGCAGCTCGTGCTCTTCCACGACCGCACGACCGAGGACGCGGCGGCGAAGCTCAAGGCGGCGCTGTACCAGCTGC
TGATGCGGTTCAGCGAGCTGTTCGCGTCCGATTTGACGACGCTCTCGTCTGAACTGCCGCCGAACGTGGTGCTCTCGCCCGAGCAGGTTGGCCACATACA
CATGGATGTCTCGGAGGGTGTGACTGTCGGACACTAACACGTTGTGTGTGTATGGCAGCGCACTATGATCGAGGCTCGCTTCCTGCGGTTCGCGGACGAG
GTGCAGACTGTGCTGGAAGGTCCGCTGGCACATGACGAAACCAGCAAGCAGGTGTAGCTCAGACCAAGGAGGGAAAAGTAAGTGTAAACACGACCGCAGT
GTGCCCCGCGCTCTGATTTCACGAGGTGGAGCGCTCCCGAGCGCGATCAAATAGATAATACCTGCCGCCGACTCAGTCGAGCACGCTCTTCTTGCGCGGC
TCGGACGACCGCAGCGCTCGGTCGCTCGACGTGAACCCCCAGAGCTCAACGAGCACGCACGAGAACTCCTGCGAGCCCACGAGCGGCCGCGAGTTGTAGG
TCTCGCACGCCCCCGTTGTACCCGACGACAAGTCCCCGTCCTGTTGTCAGCATTGCAAGCACGGTGAGCTCATTGTCACAATCGTCAACAAGCAGCAATG
GCGTGGTGGCGTACCAGATACAAACCGAAGCTCCCGCCGCCGCCCATGACGAGCGATTCCTCCGAGCACAGCATGAAGTAGCTGTTCTTGCGGCTCCATG
GGTACTTGGCGAAGCTGAGGACGCCACTCGCAGCCTCGCCGGCGCTGCCCCCCTTGGCGTTGGCGAAGGAGAACAGGAAGCTCTCGCCGTTTCCGTAGTA
CTGCGCCGCGCGGTGCCACTCGTCGGACGCGAAGCCGCCGAACACGTTGCCCTTCTCGTCCTTGACGACCAGGAGCGACGGACTCTGGCCCTTGGCGAGC
AGCAGCAGCGTGTCGAGCGACGAGCCGTGCGCCTCCGTGCTGTACAGCAGGCTCCACCTGCACAACTGGCAGGTTAGCGGCAAAACGTGGTCGAGGTACG
CGACCTGCTCGAGCGTGAGGACTCCAGTCGCGTCCAGCAGCTTGGTCTTGTACTCATCCACGCTGTTTGCGAACGACGGTCGCTTGAGGAACCGCGGTGG
AGATGGTGGTCCCGTAACAGCGGCGCTCGATGGAGCGGCGGCTTCGTTCCCATCCCCAACGACCCCGTCAACTGCTTCAGCTCCATCGCCAGTCGGAGCC
ACAGCTTCAGCGCTGTCTCCCTCTGTCGCATGGGTCATCTCTTGAAACATGTCCTCCCATTGGTCGCGCATCTCTTCAACCGAAGCGGGCGAACGCTTGA
GTATCTCGTCCAGCTTGGCCTCTGTCTCGCAGAAGACGCGCGTGAAGGACGCCTCCTGCGGGTCCAGCATGCTCCAGATCTGGTCGAACATGTGGAACAT
GAGCACGAAGAGCTTGAAGAAGTAGGCCTCCTCGTCGAACAGCTCCCAGAACGGTTCGACCGATAGCGCCACCAGGTTGAGGTGCGGTGCCTCGGGCGAC
GGCCTGCATGGAACGCACACCGTTCAGTCATCCTCACAAATCAGCATCACTACACTCACAGCCATATACTCACACGAGCTTGAGCTGGTTGATGAGCGAC
CGGCAGATGGCCGAGGCCACAAGTCCGGCGTCGAACGACGAGGTTCCCGCTGTGGTCGGCAACGCGCGCTCATACAGTCGCGGCAGCACATCGTCCGTGT
AGTTCTTGACCATGAATGCTACAGCACGCAGCAGTAGCACACCACCCTTTTCAAAGTTGCTCAGCACCGTCGAGCGGTTGAACCCGTGCTTCTCCCAGAT
CTCCACGAGCGAGCGGTTCGCGGGGTCGGCATACGGCTCAATGCGAGAGCTGACGACAGGATGCGTCTGGCTCCGTGTGGGCACGCCGATCCGCGTGCCC
GTGCCGCTCGCAGTCCGGAAATGCGCTGACGAGCTCATGTCTGTGCCGCTCGCGGTCCTCAACGAATCAACAGCAGCAGCGGCATCGGAGGCTACCGGAT
CGAGCACAAGATCTTCCATCGGCAAAATTGAGCTTCGCTCGGAGCTCAGCGGAGCCGCAGTGGCCGCTCGAGAGCGATGCAGTTCATTGGTGGCGACAGG
TGATTGTGCCTCTTGCAGATGTGCGCCAGATTCGCCGGCTTCGATGTTGAGGATGCCGTCGGTGAAGAGGATGGTAATCTCGTCCAAGTGCTGCTTGTCC
GACATGAAGTTGACCTGCGGCTTCATCTTGTACAACTGGTGGATGTTCAGCAGCGCCTCCTTCTTCGCCTCGAGTCGCTTCAGCGCGTCCGAGACCTGCA
CTCGCACGTCCTGGAAGATGACGTCGTAGTGCTGGATCATGCGCTCGACGACCTGCGCGCCGACAGCCGCGTACCGCACATCCTGGTACTGCGAGTGCGT
GCTGCGCCGCTGGCCGGACGAAAGCGTGTGCGCCGGCTCGATCTTGAAGGCGATGACCGGCGCGAGCGCCGTCGACGACGTCATGGCGTCCACGCCGTTG
AGCTCAGCGTGCTCGGGAAGCTGCAGGAAGTGCATGAGTCCGATCACCTTCTCGAGCACGAACTTGCAGTGAACCGGCAGCTCCTGCACCAGACACGTGA
GGTTCCGCACGCTCGCTTCCTCGTCGCGCAAGCGGCCAGACGCCACAAACGCGTCGTACTTTTCCGATGTGAGCAGCGGGTCAGGGAGGTTCTTGAAGAA
GTCGAGCAGCAACGCGCCGGCGCCGAGCGGTTCCAAGTCCGGCGGGAGTCCGCCTTCCATCTCCACCAGATCGCGAAGCTGGCTAATGTGCACGTTGAGC
ACCGTGGCGCGGAAGAGGCGCGGCGTGTCGGGGTGGTCCATCAGAAAGTCGATGCAGTCCTGTACGAGGTTCGGGATCGCGAGCACCGGGTCGATCAGCG
CGAACCGCGAGTGGTATGGGTTCTTGCACAGGTACGCGAGGCTCACACCGAAGACATGCTGCCACGGCTTGATGGCCTTGTTGCGGTGGATGAAGTTCAC
GACCGGCACTTCGACGACCACTTCTTCCGGTGGCGGCGACGGAGCTGACGGCGGCGAGCTCGCTCCGTCTGGAGTCGGATCCGACTTCTCCTCTTCCACC
TCACCGAGCGCAGCTGCAGACGGCTCGGCAGACAGCTCAGCAACCGAAGACGGAGCAGTGGCGAGGAGTGGGGTGTTCTCATTGACGCTAGCTTCTTCGG
TGGTCATCACTGGTGCGGGCGGCGGCAATAGCGACCCGATCTCCGTCGCGATCTCAGCAGCGACCGCGACGGCGGTCTCGCTCGTTGTCGTGGCCGATTC
AGCCGGCGCATGGAAGGGCTCGTCGCTCACCTCCATGGCGAAGTTGACGCTGCGGATCTCGATCACCATCTGGAGGAACAGGCCGAGCCCTTCGCTGCAG
CGGATGAGCGACCACTCCTCGTAGCTAGAGCGGATCAGCTGCTCGCACGCGAGCGAGAAGATCATCTGCCATGGCACGCGGCGTTAGCAAAACACGAACA
CAGAGATATGAGATCGATCTTGACTCCCTAATTCAATACCATGAGGCTCACTTCGAGCGTGTGGCTGTTGAGCGCCAGCTTGAGCCAGCAGCGCTCTTTG
CCCGCATCGTCCTGCCAAAGCCCACATCCACAACGTTAGCAACAGGCACTGCATCCAAATATGGTGTAAGCATCTGGTAGTCACCTCAGTGAGCAGCGCG
GCCGACACGACGCTCTCCACGAGCGCCGGTTCGTCCACGACGAGCGTGCTCGAGTAGAGCACGTTCCACCACGACACGTCCTGCTCGGCCGAGTGCTTGA
GCCCGAGCTTGACGCAGTTCTCCAGCGCCAGACCTTCATTGTCCGCATCAACAAAGCATCAGCGTCAATAAGTGGAGAAACATGAGCGATCGCCATGTTC
ACTGCGAGCGGCTCCGTACAGAGTTCGTGGACGCAGGGGTCGTCCAGCGTCAGTGCCACAGCTGGAGATGTCGCCCGTTCGTTACTCTCCGCGCTCTGGA
GGCCTCCTGTCACCGCTTCTTCAACCAGCAGAGCGTCTCCCGACTGCTCCTCGGCGAGGATCGCCTGCGCCACCGCCGTGCGGTCCTCCACGGCCTGCAG
CACCTCCAGCGTGGCGATCTTAAGCCGAGTCTGTGTACCACGCCAATGTATTTCACCTTAGCCCCTCAGTAGCAACAGCGGTGCTGCCTGATCGCCGCAT
ATTCCCCCACGTACCAGAGCGTCGAAGCGCCGGCGCAGCGCCTCGTCCTCGCGGTCCTCGGCGCGCGCGGCGAACCACTGCGCGATCTTGCCGAGCATTC
TCGCTGCGCGTCGCCGGACTGGGTCGCCGCCCTACTCGAAAGGCGCGGACGGATGGGCCGGTGGTCGAGACGGTCGCCTCGCGCTGGAGGCGCCAGGGGC
GGCGCAACGCGCGGCCGGCAAATTTAGCGCGTCAGCTCCTTGCTTCTCAAAAATAGACGGGCGAGTTTGGTGTCGCCGCAGTGCAGTTCGGTAATTTGGG
TTTTGGAGTGTCACAACATCGAGGGAGAGACCAAAATTGAGTGACGTCAGCGTCATCAGCGAAAAGCGCGGGAAGTGGATTTGCCAAGGCAAGTCCAACA
TGGGAAAGCCAGGGTTGAAGCTGTCGGTGGACGTGGAGGCGGCTCGAGAGGACGAACACGAAAGCGGAGAGGCGGAGAGCCGAGAGTCGTCGCCGCGCGT
GGCCAAGGCGCTGTTCCAGAGCGGCAGCGAGGGCGAGAGCGACAAGGAAAATGACGCCAAATTGGTGGAAACAGTCCGCCACCGCCAGCGGCGCAGCGAG
CGAAGACACGAGTTCTTGGCGTCGCCCATGGGGCGGAGGCGGTCGCGGGACCATCGCCACTCGCCATTGCCGTCTGGTCGGCCGAGTCCAGCGAGCAGGT
TGGACTTTGTCGAGTTGAATGGTGCGATTGGATGAAGGTTGTGAGCATGTGAATGATGTTGTGGACAGTGGACGATCGGTGTCGCCGCCGTGGAGCAGCC
CCTCCGTGGTGTTAGCCAACAATCTGGGGACGAAATTGGCCGTCAAGAGCCCTCCGTTCGTTGATCTAACGACAGGTTTGTTGTTGGCAGGATCCTTTGA
CGTAAAGGATGATTGAGATGCTGACGATTTGTTGCTGAAATGCAGACCTAGTTGGGAGACGGATGCTGCTCAAGCTGGCAGTCAAAGGCGCGACGGTACT
CGACTGAGTATTGTCTACGGTGCCTGCATGTTGAGATTGTTAATAGTCAGGTGGTGTATCGTGACAACAGACGCCACGGGTGCGGTCGATGGACGAGTTG
AAGACGATCTGCTGGCTCGGCACTGGTGTCTCGGGAGAAGTGCACAAGGTGCGCTCGGTCTGCTAGCCTTCTTAGCCATACGAGGATCCGATGTTGACTG
GATTGTCGAGCCAATAGGTCAAGGTGGAGGCGACTGGCTCCTGCTACGCGGTCAAACGATCGACGGACGAGCTGCGAAGTGTGCGAGAGCGGTAGGTCTG
CACCAGATCATCAGAATCGAGTGAGCGACTCTAACAGATGCAGTTCGCAGGGATCTGTTGTTGCGAGAAATCCGAATGGTGTCGAAGATCTCGCCAGTGG
CCTCCAACTTTGACCACATTGCTCGATACTACCAAGCGTGGCAGGAGAACGGTACATATTGCAGACCGATTCTGCATTCACCCAGTCATCTGACGAGAGC
TCTGTCTGCATTGTAGGATACTTCTTTTTGCTGCTGGAGTTGTGCGAAGGCGGTACGCTCAAGGATTTCTTGGCGTGCCACGATCGCCCGACGCTGTCCG
AGTCGTGCGTGTGGCATATCCTCCACCACGCTGCGAGTGGGGTTGCAGTGCTGCACGAGCATGGGATCGTCCATTTGGATATCAAGCCGGAGAACCTCTT
CATCGCCTTGTCTGGAGCGCTGAAGATCGGGGACTTTGGCATGGCAACGGAGGTGATCGCTGAATCCACTGCAGGGACTGAAGAACCAGAGGGCGACGCG
GCGTATATGGCGCCGGAGCTGCTCTCCAGCTCGAACCGACTCCCTCCAGCAGACATATTTTGTCTAGGTGAGCTGCCATCAATGTGGAGTCGCAGCAGGC
GGCTATGCGCTGACAGGTATAATGTGTATCGCGTCCAGGCATATCCATGTTCGAAGTGGTATCCGGCCGCGAGCTGCCTTCGGAAGGCGACGAATGGCAC
GCTCTGCGACAAGCACGACTACCGAGCATGCCAGCCGACTACTCGGACGAACTTCGTCATCTCATCGTTGAGGTCCGATCATGAGCTATTTGCTCGACAT
GTGCACTTACAATGGAGGCTAACTGGTATGCTGGCGCCTCAGATGATGCATCCAGACCCCACACGCCGTCCCACCGCGTCTGCAGTGGTGCAACAAGCTT
CAGCGCACCAGTCGCCAGAGTCGATGGCGACATTTCTTGAGGTACAGTGAGGCATGGCATCGCTGTGTATGTCCGTCTATGTGATACTGATGGTCGTTGC
ATTTGGTTAGCACGTTCGCCATCGAGTCGCAAGCCCCGTGGCGCCATCCCGCGCAAGCCAACGCGCGCAGGTGATCAAGACTCCTCGAAAGCGGCGCATT
TCACTGCCTTGACGGATGGGTACACATCTGATACAAATTGCATTTTTAACATTGTACTATTGAAATTTTACTGAAACGAGTGTGTAACCTATGCTGTGGT
TACTGACCTTAACCGGTCAACATTTGGGTCGAGACCGGTCCGCCAGTCAATCCTGGCGGGTGGTCGCGAGCTCGAAAATTGCCTTGGTGCTGCCGCATTG
GTCTCCAGCCAAGTCAGTCTCTCTTTCTTGCGTGATAACAAAAGTACGTTGTGGTTGATGCTTTGATGGGCGGCTGCCAGCGCGAATGTCGACGGCTCAC
GCGATTGCTGTGTCTGCATGATGAACCTACAGTGAAGTTCAACTCGACGGTCTCCTCCTCGCGCCGCAAGAGCCGCAAGGCCCACTTCGGCGCGCACTCG
ACGGCGCGCCGCGTGCTCATGAGCGCGCCGCTGTCGAAGGAGCTGCAGAGCAAGTACAATGTAAGTTAGTGGGGAGGGAGCTGGCACTCCGGTGCCGCCG
TAACGCCCACTATCAGCGAGTAAGCCCATGTCAGTTCCCGAGGTTTCTCTCTCGAGCCTCGGGCTGGCACTTCATGGCATCGTGTGATTCGTAAGTGCCG
GTCTCGAGCCGCGCCGTGGGAGACGACGACAGCAAAAGCTTCTGTGGACGTCGTGGACGCTGGAGCTGACTGTGTTGTGGTGACAGGTTCGCTCGCTCCC
GATCCGCCGTGACGACGAGGTGACGATCGTGCGTGGCTCGTTCAAGAACCGTGAGGGCCGCGTGACGGCTTGCTACCGCAAGAAGTTCGTCATCCACGTC
GAGCGCGTGGTGCGCGAGAAGGCCAACGGCGCCTCGGTGCCGGTGGGCATTGACGCGTCCAAGGTCTTGATCACCAAGATCAAGCTCGACAAGGACCGCA
AGAAGATTCTGGACCGCAAGAACCGTGCGGCCGGCTCGGACAAGGGCAAGTTCACGGAGCAGGACGTGGCCATGGCCAACGTCGACTAAGCGCGCAGAGG
ACCGACCCGCCAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGTTATCGTAACACGGAAAGAGCCATGCACACTGGAGTGAGCGTG
GATACTACTATATATGACTTGGGTCACCCGACTCGCAGCTTCTGCATCTCGTCCTCGATCATGCTCTTGAGCGTGGTGGTCGGCTGGTCGGACACGAGCT
CGACGAGCAGGTTGATGAAGTCGACCTCGCGCTCCGAGAACTCGCGCAGCGACATCTCCTGCAGCTCGAGGCGGCGCAGCAGCTTGTTGACTAGCGGCAC
GGCATGCGGCAGCGATCGCTTGACTGCCGCAAAGAGCTTATCCTCGGCCTCTTTGGTCTCGCTCGTGCGCTGCCACTGCGGCCAGTGATTGCCGCGAGAA
CTCTTCGGGTCGTCCCGCAGCTGACTCATGCGGTAGCCGTGCTTCTTGACGAAGCGATCGAGGATCTCTGCCTTCTTTTGCTCCTGCAGGTGACGCGATG
TGAGTGTACATACCACTGCCAATACCTCTCAAGTACTTGATCCGCACCGTTTCGACGGACGCCAAGTACATCTTGGTCGCCAACAGTTCCTCGGTTGTCG
CCGCCTTGTCCAGCAGCAGCTGCGCGTTCTCCTTGTTCAGCAGCTCGGCCTTTTCCACCGCCTGGTTCATCTCGGCATTGAGCCGCAGTTTGCCGAGCCG
CGTGGCCACCAGCACTTCTTCCTTCTCGCTCAGATCCTTCGACAGCTTGCCGACTTTGCGGGTCGAGTCGTCGATCAGCTTGTTGTACACGAGAAACTGT
CTGCTCGCATTGCAAAGCAACCTCATCAACGATTCACGATTTGACCAAGTGACAGCACGATCGACCGTACCGCTCGCGTTTGCGGTGCACAGCCAGCTCT
TGCTCGATCTTGAGCTTCTCGTCCACAGCCTGCTGGTATTTCTTCTTGAAATCTGGGACAGAGCTATAAGAATCTGAGCTGGAGAGCTGTCACATTTGCA
CCACAGTTCATCGTTAGTCGGGCGACACTTCGCCACCACATTGTGCGAATGCACCTTGAGTTCGAGGGCGACATTCCGAGCCTGCAGCTGCTGCACCTGT
TTGTTCAATGCGTCCACCTCTTGGTCGTATTGCTCGAACACTTGCGGCACAGCAGTGTGCTTCTCGAGCACACGGATCTTGCGACGCAGCGTCACGCTCG
CGAGCTTCATGTTCTCGATCTGCAACTCGAACATGGCGCGGAGCTCCTCCATATCCCGATGCGCCTCGGCCGCACGACTCTCGGCGTCTTCTCGGAACTT
CTGCTGCTCGCGCACGATCGTCAGCAGCGCGTCGTAGTTCTTACGCAGCAGCGCCGCGTCCGCGGCCTGCACTTTGTTGGCCGTGGCCGCATCCAGACCT
TCCACTGGAGGTGGCGTCAATACTGACATGGGCACTCCTGCTCGATCGCACTGCGCTTCAAAATCAACTGGAGTCTCGACTGGCTTTGAATACGATCTCG
GGCTTGATGACTGAAGCTGAATAGCAGCTTTGGCTTGCTGAGGTGAACGCTTGGGGGTTGCTGGCAGCGGTCTAACATCCGACGAGGTTGCTCGGACGAA
TTTTTCTCGAGAGGTTTCGCCTTGTGGCGGGGCATATCCATCGTGATCACTACCCCCTGTCACAACGTTCGCGACGTCTGCCAGTTCGTGAATTCCCTGG
TAGCCGTAGTCGCTGTATCGGCTGCTGTCGTCGCTACCACGCGAAAGTGGGCGGCGCGGGCTGGAGGTGGCGCCTGCTAGCGTTGTCAGATCGACAGGGT
GCTCGCTTAGGTCAGCATCAGCTTGCGGGGTGTTGTGTATGCTTTCCAGTGTATGAGGCGCGGGAAGCGAGCTTGCTGACTGCACCGATCGTGGCGAGTT
GATATCGCTGGCTGAGCTGTTCGACTGCATTGACTGACGAAGTCGCTCGTAGATCTCGTTCACGCTTGGCGTGTGTGGAGAACAAAGTCTGGCGTCGTCG
CTCATCTCAACATCCACATCAGCAACGTCCATGCATTGCACAGCGTCAACCCTGGATCGTGCAAGCACCTGAACCTCGTGCGCGGGAGAAATGGTGTCGA
TCTGACCTCCCAGAATGTCACGCTTTCGCTGCTGGAAATTTTCGAGCCACTGCATTGCCTCCGATTCGGAAGGAAGCACCGCATCGGTAGCCTGCAGCTG
ATCAGAAGGCAATGCCAAATCTTCCGTTGTTAGTCGATCTGGTGAACCTGGAGGCGACCCAGACGCGGCGAGGCGGCTCAGCATCGACTCTCCGACGATA
ACTGCTGCCTGCAACTCGACCGACAGCTGTGTCTGATGCTCTGCCACAGGCAACGGTTCTCGCGTTTCATCAGGAACCGGCTCATCGGGAGGCGGATGAA
ACCCAAGCTGGTCAAAATCGACGCCACGAAGCCGCCGACACAGACAGGTGTAGCCTTTGAGGTTGGCTACAGCGTTGAGCAGCGCCACGCTCTCACGCAG
ATTCGAGCGCGAGTCAATGATGTTGGCGTACAGGAACGTCTGGGTATTGGCGGTCAGCAGCGGAAGCATAAAGTTGGCCAGCACGGTCGAGCGGGGCTGG
TAGCGCGCCAACCTCGGCGACAATGGTGAGTCGACAGTCGGTGGAGAGCTGCTTTGATCACTCGCAGATGCTGGTCGGGGCTGAATCGAAGACTGTAGGG
AGGCGCGCAGCGAGGAAGCTCCTTGGCGAGTCGATAGCAGCGGCTGTCGGAGCTCCTGTAGGATCTCGAGCAGCTCGCGCTTCTCCTCGGCAGCGACGGG
ATCGGTGAAGTCTTTCAAATCGACGAGGTCGACAACGTGGAGTGAACTAACTTGGCCGTGATGGAAGAATGCAAGTCTCAGGAAAAAGTGTGCGTGCTCG
GCGTTCTGCTTCATCACGATGCGGTTGGTCTTGGCAGTCTGAAGGATCCGGCAAGCTCCAGAAAGCGACCTCGCCTCGAGCGACACAAAGGTGAGCGAAC
TGCTTGGAGAACGGGACGACGCCTGAGCAGGCGGTGATGGCCTCGGTGTCGGTGCCTTGAGCAAGTCGACAGCTTGATTATTAACCACGACCCAACTGCT
GATGCCGAGTCGCCACCCATCGCTCGCTTGAACAGCATTGCGCGAGAAGAACTCGTGCAGTAATGCACCGATCTGTCCGTACAACTCCGTCGCATCCTTC
TCAGACAAGTTCTTGTGTGGAGCGCCAGCCAAACCCGTGCTCTTCCCGAAGAGCAGCCGGAACTTCTGGGTCGGATGCACGCCGCTCGCGATCAGGTTGG
TGTTGATCCCTCGACACGCATTGTGCAGAGCGAGCTGCGTGATCTCTCGATAGAAGTCCATGTCGAGCGACGGCGAATTCGGTCGAAACACTGCGTGGAG
ATCCCACTCGACCGTCGTGGTCTTCGAGTCGAATGCGCTTCCGTTGGCTGCAGTCGTCTCGGTGTGCGAGCTGCTGTTGACGGGGGATGATGACGGACTG
TGGCCACCATCGCGAAGCGATGGCGCCACGCAGCGGACAGAATTGCGGTGCGACGCGACCTCGAACACTGGCGCAGCTCGATTCGCCGCCGTGATGTAGC
ACGACACATGGATCT