Description :
From Genome Similarity Track
Location :
Scaffold_1988:1491- 5329
Transcript NameFunction/comments
Phypl_g14507hypothetical protein

Sequence
3838 bases(100 bases per row)
GATCTCTTCTACCTCATATTCGCCTACCAGATGATCTGGTTCCCAGCTATCTTCTGGAAGcaactcctcgtcgaaggccaGGCGCGAATTCTCGGTCATG
TCCTGCGCCAATCGAGTTTTCGGACGACTGGGAAATTCATTGACTGCCTTGAGTCTAGACACATGGACCACGGGGTAGAAGCGATACCCACTCCGATCTG
GAAGATCCAGCTCGTAAGCGAACTCTTCGATCTTGCGCTTAATCCTAAAAGGACCATGCCAGCGATGAGCCAATTTCTTCGTTAGCCCTGGcttgacgcg
ctccatgTATAGCCAGACCCTGCTCCCAACTTTGAAAAGAGACCTCGCTGGCCCCTCGACATCATCGTGTGGGTCTACTGAAGCCTCTGGGCCTCCTAAC
GACGTTTCGTTCGAACTTGGGCGCGGCACCGAAGCTGTCTCTAGTCGACCTAGAGCATCATTGTGCTCTTTGGCTCGTCGTGCTTTTCCCGACGCCTGAT
ACTCCTTAGCCATAGTCAGTGAAATTTCTTGTTGCCGATTAACTTCGCGCCTCCACGTCAACGCATCAGACTGTCTTCCGAGTCCCTGTCGGAGGGAAGA
CGACATAGTCTTGAGTGTAGATCGTGCATCCCACCCATGAACGAGGTAAAACGGTGTCTCTTTTCGTGTTGTGTCTTGAGAGGTATTGATGGCGAACACC
AACCTTTCAGCAATCTCATCCCAGTCTTTCTGTAGAGGGCCTTCCGCGTATACACGTACTGAAGTCATCACCGATTTCACCGATCGTTCTTGCTGTCCAT
TAGCTTGTGGGCGATAGTTCAATGTTGCCCGAGATCTCGACTGCATCATTTCTGTGAAGGCTTGAAAAACTTCACTCATGAAGGGTGGGTCTCGATCGTG
TCTGATCAACGACGGCGCTCCAAACCTTCGGTAGACGCACTCTTCAAACACTCGAGCTACGCTGAGGGCCGAGGTGTCTGACATTGCTTTGGCCATGGTG
AAGCCCATGAACGAGCACTGAAACAACAGCAACGCAGAGTTGCCCCTGCGAGTCTTTGGCAGTGGTATTACAAAATCCATCGAAACAATCTGGAACGGAC
GCTCGGTTAACACATTGCCGGGTGAGTAACCCCGTAGCTGTGGCTTGCTTTTGCTCGAACTGCAGTCTGGACAGGACTTCACGTGTTTCTCCACATCGGC
GTACAACCCAGCCCAATAGTAGTCGGACCTAACACGCTGAGATGTCCGCACCACGCCTTGATGACCAATCATGACAGTTCTGTAAGACCTCTTGAATCAT
CGTTGTCGGTACCACTAGTCGTAGCTTCGTTTCTTCTTGCCAGCCTTTGTCATAGCGACGGTTCAGCCCAAGGTAGTGGAGCACACCATCCTCAGATAAA
ACGAATCGATCCGCGTACTTCCATGCACCTCGGGTTTCTCGGTAGCGCAGATTCTCTGCGTTACCTTTCAACACCGTTTTAAGGTTTGCCGACTtcagct
cttcatcttgtgcCCAGGCAATCCGTTTTCTTCGCTCACGTTGAATCTCCATCGGGTCGACATCTGTTGCGTCCGAAACTGCTGGTGATACCGTATTGTT
GAGATGATGTGAAGTATTACCGTCTGGTGAACGCTCGCTGGGTGCTTCCGCCCGTTCTCCACTGGGTTTTCTTGCTCCTGGGTGGTGCAGCGAGTGTTCA
TCGGCAAACCTGACGCGCTTCCTGACTTTTGCCTGCCTTCGAGTCATTACAGTCATTTCTCCGTGGTCGACTGGAGTGTCTCTTCGCACGAAATTCTCAA
AGGTTTTCCGCTGTGAGAACTCGTTACCGGCCATAGTTGCAATGGGATGCATAGGATCACGTGGTTCCACCTCCGCCTGGTCTTCCATCGGTTCGTAGAT
TACTTCCTGGATGCGGTTCAAAGTCATCAGCTCATCCTTTCGAGATTCGGCGAGGACCACCCAGCTCATTTTGGACTCCAAAGCCTCGGTGTTTTATGAA
CATTCAGCAATGTCACGAGAGACTCCTTCCGACATGCGATCACCCCTAGATATTGTTGGATCGCGAGCCTAGAGTCACCCACAATGACTAAATCACCGGC
GCTATACTCAATAACTACTTTGACACCATTGTTCATCCCTGTATACTCAGCGAGGTTTAAAGTGGTAGACGAGAGGTAAGCGTTCGCAGCGATCACTATT
TTTCACTCCGGTAACCTCCACAATACCCACGAGCAACTCCCATAACCGCCATACTTCTCTGTTTTCGCTGATCCATTAAAAGACATCACGAGCCCTCTAT
CGTCTCTTGGTAGCCTCGCGTAGCGAAGTAAGGGGTCCATTCGAATTGTCGGAGAGCCTTTTGTTGGTGGTGTTAGCGGCGCAAGTGATTTCTCCAGGTC
AACAAAATTCGTTATGCTAGCCTGGAGTAGCTGTGCAAATGCCAAGTCTGTCTCCTTCACTCGCTTGACGATAAGATGCCACGGTGATAGTAATACCGCA
AATTGGACTGACCGTCCAAACACCGATTTTGACTTGTGTACCCACTCCAGCGTCGAGAACCTGGTATAGACATGTAGTGTTGATCCAGCCAGCTGTGTGT
AGCAGGTCTTCAGCAATAGCAACAGAGCTAATACTTCCTTTTCTGCAGGATGATAATTCATTTCAGCGTCCTTGAGCACTCTGCCGAGGAATCGAACCGG
GCACATATTGCCATCATGTTCTTGCATCAATGTGGTACTCAATGCCCATTCGTTCGCAAACAGCATAACGTGAACATTTCTGGAACATTCGAAGTGCTTT
AGTATCGGAGCTTCTGCCACCTTCTCCTGTAGCACGGTGGGCTACTGCGAGGTTGCCTCTGTTCCAAAGTCTTCTTCCTTGAGCTGGTACAAAGCTGCTC
CATAGACCGCGAAGTCTTGAATGAATCGACTATAGTAGTCCAGTGCTCCAAGGAACGATTGCATCCCACGTTTTGACGATGGGAACGAAAGCTCGGTGAT
AGCGTGAAACTTCTTCGTATCCGCTTTTTTGCCGTCTGGGGAAATTTCATGAGACAGGAACCCAACCTTGGGTTGAACAAATATGCTTTTGGTGAAACTA
ACGCTGATCCAACATTGAGCAAACCGTGCCAACAATCGGTCCAGAGTGGCTAAACAGGAGCTGAAAGTCTCGCCACCGAAGCAAATACCATCCGTGAACG
ACCGTCTACCGAAAACAGGCACCAGCGACGATTCGTCGGCTTCTCCAGCCATGAACATGTTCACTACAGAGCTATTAACCAGTTGTAATACAGGATCAGT
GTCCACCGATGCTTCGTGGTCGGCCTCGAACTTAGTTTGAATTGATTCCTCGTTGCTGCATTGGCGAAGTCGTCTAGCCTTGTCTTCAGCCGCTCGCATT
AGTTCTGCAAAATGCACCCAGCCTCCTTTCGGCTGAGCGAAGCCTCACAGCGCGTTGTCAATCATACGCTGGTATATCATAGGTGCATTCTTCAGCCCAA
ACGGCATGCACAACCACTCGAAATGCCCCAATGCACACACGAATGCAGATATCTCCCGTGCTCGGAGGGTCATCATAACGGCCCAAAAACCGCTCGCAGC
GTCCAAAGAACAAAACCACAGGTAGCTCTTAAGATCCGTCAACAAATCGTCGACTAGCGGCATGGTATATTCCATGATTGCTGTAATCGCATTCACCATC
TTGTAATCAATGCAAAGTCGGATATCTTGTCCGTTCTTTTTCAGCACAATCACGATTGGCGATGCCCATGGACTGTCAGAGAACGAAATCAAACCGGCTC
TCAGCAGACCCTTCAACAATTCGTAAAGCTTGCCGAGG