Description :
From Genome Similarity Track
Location :
Scaffold_2342:1491- 3883
Transcript NameFunction/comments
Phypl_g14978hypothetical protein PHYSODRAFT_491362

Sequence
2392 bases(100 bases per row)
TGTCTGCGCCAAAGCCTACCAAGAAcgccgtcagctccgcgAAGGAGTTCAAGACCCTGTGCATCGCTGCGAGCTAGACGTACAAGATTCGCGTGGATAA
TGAGGCCATCCGTCGCCTGCGACTTACCATGAACACGACGATCGCCTCCGCAAGCCTTCTCCCCGAAGCGATCCAAGTCATCAtcgcctcgctcgctgaA
CGGAAGACGCGCAGAATCGGCCTTGAAGACGTGCGCCAATGGCTggctcctcctgcacctgcggTCGACGAAGATTCGGACGAAGAGGAGCGAAGCCCCG
ACAGAGACCTCAAGGGTGAGTCCGTGCACTATgtccgcaagctgctgaactGGAAGCGCGAAAAGCGGGTGACTTACTACCTCGTCGACCGGGAGCCGAT
TTGGGAGCCGAAAGCCCACTTGAACCagaagctcgtcgccgccttcgagaaggagcgccatcttcttgTCCGTAAGACCTTCCTTGAAAAAGTGGCTGTG
GAGGACAACACGCCAACCAACACGGAAGGATAGGCATCAGGGGCAAACACAAGCGTATTACAAGCTTAGGAGTCTGAACGCAAAGGATATGAAGTTGTAG
CACCGATTGAACACTAAGCTTAACCTCCGAATGGAACAGCAAAGTTAAGNGAATGGAACAGCAAAGTTAACCTCGTCACAGAGTACGCGAACATGTAATT
TGAGTGCACCATCGAACACAAAGCTTAACCTCCTTCCGGAACAGCAAAGTTAACATCAACGCTAGCTAGCACACCTCCCACAAACAGCAGAGGCGGCCGT
ATATCGCACAAACATGTACACATACAAACATGCAGTTAGCCCGTGGCGGGGGCCCTTAGGCTAGCGAGCAACTTGTCCGTTGCGAGAAAAACCGAGAATG
ACGTTGTCCAGACCCCAGCGATAGCTACAAGCCAGTCATTTGAATATAACCTTCTTTTTGAGGTTGTACCCACGTTGATTGTGCAAGCCAGTCAGTGACC
GAGGTATTTACGCGTAAAAACTACCGTAAAATGGGCCAGGTGCTCCTAATAGTGTACCTCAACTTCCGGGTCGCGGCCTCATTTGCCAATCTACCACGGC
GCGCTAACATGTCCCCGCGGCTCTCTGAGGCTGAAATCAGCATGATTTGTTTTTCGATGTTTTCTTGGCCCACGGGCCGTTTCAGAGCCTGTGGCGCCGC
CTATAAACCCCCTCTAATCTGCCCTGGCGCACGCCCTCTGGATGTGCACATCCAATTTTAGCTCACCTAAATGCGTACAACCTTACATAGCATAAACAAC
CTCTACACTAAATAGACCTGACTGGGTGCGGGTCGGAGCCCGTCGGAAGTCGGAGATTTTTTGCGATGGATGAATATAGTTGTTTTTCCGACAGATAGAA
CTACAGGATTGTGGGCAAGCCAAATGCGATTGCATATTAGCCTATCAGATCACTTCAATTGAGTATTTTAGCCAATTGAATCTATTAGGGCTAGGTGTGC
CGTTCCGACACTTtccgacaaatatttgtcggaACCAGCGAGAAAATATGAATATGCCGATACAAATCTTAAGACTAGAAAATATTGTTTGCATATATGT
GCCATTCAGACAACTAGGCATATTCCTAGAATAGGGGGCGTTGGTGGACGTTGCTAGACAACCACTAGTTTAGCCTACGATATTCAGCATACAGTATTCG
AaaagcagaaggagaagcatGAGCTTAGACGCTTTCGCGAATGCGAACACCGCGAAGGCACGCACCACTGCGATCGCCGCATTCAAGCGGATGCTGGAAG
CGGAGAATGTTAGCATGGAATTAGTCCAAGCTAGCATTCTCCTAGACAGCTCAGGCAAgcgcttggcggcgacgatggatCGCTTCGGCTTCTATCTCGC
CACCAACGAAAGTAAGAAGGGTAAGCTTGCACGCAATTCGGCAACGTCGTATTATAGAAACGTAAAGTTGTGGTTGTTCGATGAATACCCGCACTTACGT
GTCCCTACTGAGTTGGTCTTGCTAAAGCAAAGCAAGACCTTAGATAAGCATTGCTTAAAAAGAGAGAAAGGTGGTTTGATTAATAAGGCTCCTCCTTGTA
CTAAGGAGCATTTACAGTCTCTGATTCGCTATGTGTACAGCACAACACGCGTGTATTCCGACTACCaagacgccgcgctcgcttGTCTGATGTGGCACTG
CTTCGGCCGGTCGTCGGACCTGGGCTACATACAGAAGCAGCATGTGCCAGTATCCGCGAGCGGCACCTTCTatctgcggctgctgcgggtcAAGACATCC
GAAGAGCAGGGCCTTCCCTTGATTCCGGACAAGAGCGACTTCTTGACGTGCCctctgcacgcgctggcggtcgcACTGGCTACCCAAGATGC