Description :
From Genome Similarity Track
Location :
Scaffold_87:149068- 150085
Sequence
1017 bases(100 bases per row)
TTTGTAACAGAGCACAGCCAATGGCAAAATCCGAAGATTCACAGACGACACTGGAAGGCCGATCAGAATCTAGCAAATCCGAAATTGGAGGCATGTAGGA
GACTCTCCTTTACGACCTTACAAGCCTCTGCTTTGGTGCTAGTCCATAACCACTCCAAATCCTTTCTATGGGGATTGGATGATGGCCGAGCCATATCAGC
GTAATTCTCGCTATACTTGTGCAAGTAATTAGCAAGGCCAATCGATTTGAGTAGGTCCTTTTGGTTTCTAGGAACTGGTTAATCCACTATGGTCTTCACC
TTTGTAGTATCTGCCTGAAGGCTCCGCTTCCAAATGAAGCATCCCAAAAATGAGATCTCGTCCGCACCAAAGATACATTTTGATGCATTATCATAAAGCT
TATTAGCGCACATGCACTCGATCACAGCTCGTAAATGGTCGATGTGGTTATCCACGTCCGACCTACCCTGTTCCGTTCGACTATGGACAAATATGTCATC
AAAAAAATGTTTGTGCATACGCACGGTGAGGGCGAAACAATTACACCCCCAGACGATTAAACGTAGCCGGGGCAATGAAAATCCCCTGGGGTATAGCTAG
CCACTCTCAAAGCATGCCACTTGGAGTACTAACCGCTGTGAGCGGAATATCACTTGCTCGCATGAGCAGTTGATAATAACCATCGACCAGGTCGAGTGCA
CTGTACATTGTACATCCTGCCATTTTGTACTGAAGAACGTCCTTTCTAGGAATGGGTGTTTGTGCCGGTATAGTGGCCGCATTAATCTTATTATAAGCAT
GAACAATACACCACTTACCATTAGGTTTTTTTACACAAAATGTTGGTGTGGAATGAGGAGACTTGCTCTCGCGCAAAATTCCCGCCGCGTGCTTAGCATT
GAAAAACTCGTCGATGAAGTCACATTGTTCCTTTGGTAAAGGCCACTGCCGTGGAATGCAGTATTTGGTTCCAGGAACCAAGTCAATTTCATGACGTACG
CCCCTATCGGGAGGTAA