Description :
From Genome Similarity Track
Location :
Scaffold_5:1490417- 1495093
Sequence
4676 bases(100 bases per row)
AACCCCAACTTAGCCAACCTATAAATACATTCATTTTACAACTTACTTTAAGCTGGTTCGCTCTCTCAGACAAAACGGACCTGTGAACTACTCTTTGATT
AAGCGTTTGTATCTTCTCAGAAGCCATTTCGTCTAATGCAAGGTACTGTGTGGCCCCGTCACATTTGGTAGCTCTTGTAGTCAATCCATACTTACGCAGG
TAGACTGCCTGAACCTCTCTGAAACTCGTCGCCATGGATAGGAGCGACTTCTCCCATCGGAACGACTCACAGTTCGAGTCAGTTCGGAAGATGGCTGGCA
TCTCCGGGATGGAGTCCCTGCAGAGCTTGATGACGTCAACACCAGCCGAGCAGCTCGAGCGTGTCAATGTGTTTGACGCCTACGAGCGAGGACCCATCGC
ACATGTGCGAGGAAACCTGCAGGCTCCGGCAGTAGAAATAATCCCACCACACCCAAAGCCAATACGGCTGGAAGTAAATCCGTATGATGGGAAAGGAGGT
GAGAGATTTCACTTCTGGGCTCGAGAGGTAGGGCCCGCGATGGACACGGCTCTGATCTCGACCGAGTAACGCCGTGTTGCTTTTGAGCTCTCTCACCTTA
ACGGTCGTGCTAAGTGTTGTGCGTACTCGCGGAAGGAAACATTGCCTGGATGTTTCACGTCCTGGGCGCAGCTGTGCAAACACCTCCGAGCCGCGCGCCT
CCCAGAAACTACGTGTACCGGTGGCGTTCGCTCTTCCTCTCATACAAGCAAGGGAAGCACGAGCTGCACGAGTACGTCCAAGAGATGCGGGAGCTCACGG
TGCCCAGAGTGGGCAACCCACTTAACGAACACGTCAAGATGACTGTGTTCTAAGCCGGCTTTCGAGTGGGCCCGGCGCGCACTCAGCCGTTCCGGGTGCA
GTCAAGCACCCTCGAATTGGCGATTCAAGTAGCGCTTCAACAAGAATACAGTTATCGCTAGATATGCACGCCGGCCACAGCGTGACAAAGGAAATTCTGT
GGAGAATCCTGGTCGGGCCAACCCCATCGAACCAGTTCCCATGGAGCTTAGGTCCGCCAAGCAGCGGGACATTCACTTCTTCGGGCGCGGGAAGCTGGGC
CACTTCAAGCGTGACTGTCTCTCGGAGAGATACCGCAAGCGACCTATCCCCAAGCGTGTCCTCAAGGGTCGATGGACGAAGCCAGGATCCCGGGGACAGG
AAAAAACGCCGGAGACAAGCAGGTGGCGGGGTGTCCTACTGATGAAGAACTAAGTCTTCGTGAGCGGTGCGCGGGTGGCGCATACCACGGGAACTTAGCC
GTTAGAGCGTTCGCACTCTCTCATCGGCGAAGAGCAGGGGCGGGCTTCTTGTAGTACACGGATATGAACGGGATATGATCACTCCGTCAGAACCTTGTTC
GATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACCATTACTCGTAATAGCAACAAGTTGTCCGATGCTGTGAGAGTAAGCAATGTCAGTGCGACTG
GCCGACGGGAAGGTCGTCACTGTCTTCAGCATCCAAATGAATCTGTCCGTCCAGTTTAAAGACTTCGCCATCCCAGAACCGTTTACTGCTCTCAACATGG
ATCCCTACGATCAGATCCTGGACCTGCCCTGACTCGAGGAGCACGAGCCTAGGATCGACTGGCGAGGCAAGGAAATCGGTGCCAGCCGCCCTGCGAAGTC
CGACAGAGCATTAGAGAGTCATGTTCCTACCTCTATCAGGGCCCGGGGCGCCCGCAATGAACGCCAGTGTACCGAATCATCCAGCCGCTGCTTGGGATTC
TGCGACGTATATGACGGCTCCGAGGATGCTTCGATGGTGGCAGCGATAGGAGGCGGTGGCCAAGTGCCCACCTTAGGTCCACAAACCGGTAACATGGTTC
CGCAGACAGCAGCAACTATCACGAGCGCTGGTAATAGCATGTCCAAGGTGGGTAACAGCGCTCCACACACGGTCGTTCGAAAGAGGAAGACGTTGGATAC
GCTTCCTGTGTGGGTAGCACAGTACCACACGAGTTTCGCGTGCGTCTGGTATCGACTTCGCGACATCCCCAGACGTGGGTGATAACGTTCCACGTCACGG
TCACCGTCGACGACGAAAGTTGGATCTGAACCTCGTTCAGATCGAAGTTGCTATAAGTGACTCGGATTTCAAGGTCCGGGATCCTCCGACACGGCCGGTG
GAAGAGTGTTATCACATCTTTGATGGCGAGACCGGTTTACCCGTCAAGGAATATGGTGAGCTTGGAACCATTGCCAGCGGTTGCTGACACACTGAACCTC
GAGGAAATGACGGTCGAGGCTTTCCTGGCCATTTCAAGGCTGGGGAGATTGCCGAGACGGTGTTTGTTAGACCAGAGGTCACTCGGAAGGAGTTCAGCTC
CTTCTCTGTCTTGGACGAGGACGTCCTAGAAGCGTTGAGCAAGCAGCGTCAGACTCGCTTGGATTCGGAGATCCTTAAGAATTCCAATGATCCGGTGTAT
CCGTTAGTGACGGGGTATGCGGACGTGGAGAGCAAGCTCTCACCGACCTAACTCCCACCGGATCGAGGCGTACAGCAAAAGATCGATCTCGTGTCTCGCA
CAAAATACTACGTCACGCAACAATGGCCTCTTTCACGCAAACAGAGCGATATCATCGATCCTACATCGCTGCGAAAGCGAACGCAGGCATGGTGCGGAAG
TAAAAATTCCCGCACTCGACGCCAATTTTCTGCGTTCGGAAGCCGAAACGGAAAGTGGCGTCTAGCTCACGCTCATAACAGGCTGAAGCGCGCGACGGCG
CTGGCACATACGCCAATCCTACGAAAGGATGTGCTGTTGAACAGCATGGCCGGAAGCGTACTGTATTGTGCGCTGGATTTGGTAGACGGTGTACAACTAA
ATCCTGATGCGCGAGAGCGACATTCCGCTCACCGCGGTGAGCACTCTAATCGACATGTTATAGGAGTGGCTCGTCATACCGCAGGGCTTTTCTAAAGCCC
CGGCAGACATTCAACTCATTGGTGACGCAACTGTTCAGGCCATTGCGCGCCTTCGTACAAACTTGGACGACAGCTACGTTCATTGCGGTGCCGAGGGAGG
CAAGAAGGCTGTGGAGGTGCATTTGGGGAACCTCCGTCGAGTGTTGAAGGTGAAGCGAGCGAGCAAGCTCTACGTCAACATCGACAAAAGCGTCTTCGCG
TCTCCAGAGATCAAGGTTCTTGGCTGCAATGTCATCAAAGTCGGCGTTCGAGCTGACACAGACAAGGACAAAGCCATTCCAGCATGGCCGACACCTGGTC
GCAAAAGGATCGTCGAAAGTGGTAGTCTTGGCCAAAACGTTTTATCAGTACAGCAAAGGATATGGGGACCTTGCTAAGCCCTTGTCAAGCATCCTTCCGA
AGAATGCCGACGGGACCAGAATGATATATTTACCATCAAGACCAGTCTTCAAGCGCCTCTTGGCCTGGCCCTGCCGGATGAGTCAGCGTCGTCTGCGATG
CCAGGTCGGCATAGCTAGACACAAACGAATCATCTCGTTTCAGGCCAGGCAGCTCAAAGTTGCTGAACGGAACTGCCCTGTCCACGCCAAGGAGCTCCTG
GCAATAAAGTATGCAGTTGTGAGGTTTCGGGTTCATCTTCTTGCTCAAGGCCCTTTGTGATCTACACAGACCACGCATCCTTGAATGGCGACGAATTCGC
CTCATTTCTCTCAACGGATGATGAGGTGGCTGTTCTTTCTCGCGGAGTACAGCTTCCGCGTTGAGCACAAGCCGAGTAAGCTCGATGTGCTTCTGGACGC
CCTCTCTCAGCGTCCCGACTACGAATTGGCCCCCGTCACACGTGGGTAAGCGAATCTATACGATCATATATGCGTGGCGTATCGGGGAGTAAGGCTGTTG
TCAAGTCTCTAGCAGCAGGAACGAACACAACGTCCGACTGGATTTAGTCGCGACAGCGTTCCCGGCTTCACCTATATGAGTTGAAGAATGATTTCTTTAA
TACTGGATGGGGCCTCTACGGGTTGTCGTACCCGACGACGACGATCTTGCGTTAGACATCCTCGCGAAGGCGCACAAGCGCTCTCTACCGGCTACTTGGG
TCGCGAGAAGGCCTTCCTATCGGTTTCGCAGGCCTTCAGGTGGACCCACATGTACAACTGGGTCGCGCGGTACGTGAAGACATGCGAAACATGCCAATAA
GCTTAACACGCAGGTCATGCCTCGGCTCCGCTACATATTCTACCTGTACTGGCGGACTGTTGGAAGTCGATGAGACCTGTCTTCATCTTGGATCTTCCCG
CCGATGGACACGGCAACACCGGGATTTTGGTGTTGGTGTGTCGGCTAAGCAAGATGGTACATCTTGATCCTGTGCTCGCTATCGTCATAGGCGAACAGAC
CGCGAGGCTGTATGTTGATGGCGTGTTCCGCTATTACGGTCTCCGGGAGGCGATTGGATCGTGCCGAGACCCGCGGCTACCGGCTGCGCTCTGTAATACG
CGCTTTCCTTTGCTCGAAACCCGTCTGCAGATGACCACGGCGGGCCATCCGCAGACAGATGGACAGACAAAGCGTGTCAATCGAGTGCGCGGAAGCACCA
CGTACGTGGTCGACGCAGCTTCCAGTTGTTGAATTTGCGCTCAACAACGCGATTCACGCCTTTATGTGCTCTACGT