Description :
From Genome Similarity Track
Location :
Scaffold_42:14900- 18345
Transcript NameFunction/comments
Phyke_g2227hypothetical protein PHYSODRAFT_246058
Phyke_g2228hypothetical protein PHYSODRAFT_490699

Sequence
3445 bases(100 bases per row)
CCCCTGAGCTCACAAATGCCCCGTTCGTCGTGGACCAAGCTCTTAACGCCAAGCTGTCGCTCTGGCGAGGCCCCCTCTGGCGTCTGCGGGTCGACGCCGT
CGTAAATTCCACGTGCGAATCGCTAAGAGACGGTGACGGGGTCTGcgggaagctgctgaaggcagCCGGGCCGGAGATCGAAGTCGAGTGCGAAGCTGTG
GGCGCGTGTCGCACGGGGGAGGCAGTGATCACAAGAGGGTGCCAACTACCAGCCAAGTTCATCCTACACACTGTGGGGCCTCGCTTTTTACCTAAATACC
ACAATGCGGCAGAGCATGCATTGCACTCTTGTTACAGGAGTGTATTGTCAATTGCCAAGGAGAACGGACTGCGATCGGTGGCCATAGGGTGCATCTACAC
TCAACGCAAGGGGTATCCAAGAGAGGAGGCTTCCCATGTGGCAGTGAGAACAGTGCGCCGATTCCTAGAGTACTACGCAGACGACTTTGATCGGATTATA
TTGTGCGTGGAGTCGTTGCAAGATGAGTTCGTGTACGAGAGAGTGCTGCCGCTATACTTCCCGCGTACGATAAGGGAACAACGTGAGTCAcagaaggagc
tggcgacGCGGGATCTCGGTTCGTATCGTACCTTGCCAAGATGAGTTATATATTTGTATTAACTGAATATGATGTTGCCAAAGGGGACAGCTTGGGAGAG
CCTGTTATCGCTGAACGCAAGATTCGGATCGGCGATCTTGGGCGCTCTAATTCCTACAGCAACCAGCAGGAATGTGAGCACGTCGAAAATCAACCGGAAC
GAAGCATCAATCAGATCAGCGAGTTTACTCCAAGCGCAAGTGCCGACGAAGCAGTGAGCGACATCAAGGCATTCCATTCAATGTGGGCTAACCCAGATGT
TGAGCGCATGGGTCGattgcagcagatgcagggGGAGAGGCAGCGGCAAGCtatgaatgctgctgctgctgccgaagaaCGAAAAGGGCTCGAGAAGGCT
ACTGCCAGCACCTCCGAATGGGACTACTTAGCAGCGCTTAAGCGCGCGAGGCAGGATGACTTCTCGGATTTGAAGGCCCTCGCGTTCTGCTACTGCGGAG
GCATCGATCTAGCGGGATTGCCTGTAGTCGTATATCTCGCTGGAAAGCTGCACGTGGACGATGTCGACCTGGAGCGTGTATTGCTATTCATACTGATGAT
ACTTGACACACAGCGCGCAGCTTTGAGTCCAACCAATCCGCAGTTCAGTATGCTGTATGTGCACTCGGATGTGACAGATGAGAATCAGCCACCCAGTTCT
TGGCTCAAGCGATTGTTCCGGATTTTCGCTGCGGTAGCATCGCATCGAACACCGAGCGATCGTCCACTTCACAACCTTGGGACAGACTCGGTGTTACGCT
TCTTTTACGTTTTGGAGCCATCTCTGGGACTCAAATTTCAACTGCTTTTGTCCAAAGGGTATTGCGATGGTGGCGGCTTCTACAACCAAGTGGTATATTT
ACAGCACTCCGAGATGTTAAACAGCATCGCTCCAATTCTCCAGTTGCCATCACATATCTATACGTAAGTTTGAGCAAGTAGGTCTGTTGATCCTGCAACC
TGATGGTCTGACCATGTGTGATCGTTTGAATAGGCCAAAACAAAACACGCCTGTTCCCAGCACAAACAGTGCCTGCCCAGAAAGTGAGTCACCGTAACGA
ACAGATCTTGGTTTGCACTGAGGGGAAAAAATGTCCACAGCGCTGTGTCGCGTTTGTTGTTCTACTAACGTTACTTCCACTTGGATACTTGCTGTACAAT
CACCACGGATTGCGAGTCGGAGCCGGCAACAAGCGTGTCGGATTCGCCGTGAACTGCCAGCGCATTCCACGGCTGGAATGACGAGGCAAGTGGCTGTACC
TGGAGGCTACTTGCTCCTTTGTAAAAGCCATTGGCTGTGCCACTCAGAGAGCCAACAGTAGTCATGCTCTGGTTTCTAGTAGCAGTCCCATTAGCATCGT
TGTACCTCTCGTACTCGATGGGGTCACGAGGGTTTCGCCCGTAATGAAAGTCCCAACAGTTGACCATGGCGTCATCTCCACCCGTGTACAGAAACCGAGG
AGATGACGAGTGGAGCTTTAAAGCACGAACAGCACGCTGGTGGTATGCCTCAGTGCGGAATGGTGCATCGAGATGGCGACGATCCCAGAAACTCACACGG
CCATCATCAGCACCTGTGATCAAAAGTTCAGGCCGTGTCGGGTGGGTCTCCAATGTCGTCAAAATACTCCTTGAACTCGGACTGTGCAATTCGTACAGAC
GGCACTCAAGCATGTTAGCAGACCTAGAGAAATATTGAAGTATTGAAGCGCTTACGAACGTACTCAGTACAGCTTGTGATAGGGAACTGATTGTTCGTCG
TGAGATCCCAGATGCGAAGCTGGCTTCCAGGTGTTGAACTGTTCCCATGCATCAAATGCAAACAAGTTAAAAAGCATGCACGTCAATGTATCTTAGGCAT
ATTAGAACCACACTATCCGGCCCAATCGTACCCGACAGTAGCAACAATTGAGTCTTGGCCCAAAAATTTCACCGCGTTAATTGGCAGTCTGCTCGTGTTC
TTGTTTTCTGCATCGAATCATACACAACCTCATGAGTACCTTCAAAGTAAGCAGCACAACTCTCCCCAGTGCCCCACATACCAATCTTCTCGACACCCAT
CGAGTCATCCAGCTTGAGCCACGCGAGTGTTCCACAAGCACTAGCCGTTACGACTGTTGTGTGGCTCTCACTGACTTCCAGGCACATCGCCGCAGTGTCT
AGAAATAATTTCTCCCACTCCGGCACAGCAAACGAAGCCAGAGGTCTGCCAGTATCACCGTCTGACAtcgcgtcgtcgtcaccagaAGACGGTGCCACTC
GATAAGCGAAGATTCCCCCCGACGACGACGCGCTGAGCAGGAGATTCTCGCCCCTGGCTgccacaaactgcagcgcgtTCACATCCCCAACATGCTCCGC
CTCTGCTAAAGTACTCAGCTCACACGGACGGGAGTTGTTCTCCCCATGTCTAATGCAACCAGTCAGCGATCAAAGCAAGTTTCTAAAACGTCACAACACA
ACGCACCCAAATTCCTTGCGCAGTTCCCGCTCGTCTTGGGTGGGGCGCACAGGCAAATGCAGCGTCACGTGGTTCGTCTGCAATGGGGATCAATACGGAT
AGAGATTCGACAGTGTCAATAGAGTGCAAAATAAAGTTTTTAGATCTGTCGAATTGCATGTACCTCGTTGTCCCATCCACCGGTCGCTACCAGAGGAAGC
ACCTCGTATCcatcctgcagcgtctcaGATGCGTAACGCACGTCGCTCACCACACACAGagccttgatcttctcgGCCACGAAGTGCTTCGACACAGTAC
TCATGATGCTTGTTGACTGGGTGATCAGCTCCAACGGTCGACGCA