Description :
From Genome Similarity Track
Location :
Scaffold_204:14900- 46617
Sequence
31717 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCCGGAGATCCCGCGACCTGACCG
GACGGTTGGAATCCGCGCTCCCCGTTCAGCGAGGATGTCATGCAGGATCACCATCTGTACCATCTCCTAAAGGAGGATGGCGCTCCGCTGGATCTGAGAT
CCACCAGCCTCCCAATTCCCGGGATCCAGGACCTCGAGCGGGATCTGGAGGATTGCCCAGACTGCTGGGGCAGCTGCGGGATGCGAGCTTGGACCCGGCT
CCGTGACGAGTTGCGTCTGACCCAAGAGGAGGTGGTGACCAACGACTATGTGGGATCCACCCATGGCGGATCCACCTTAGGGGTCGGCGCGTGGAGGATC
TCCCGCGCCAAATCCCCCCTCCCTCATCGCCGGATGTAGCCCTGGCTCAACTCTCTGAGGAGTTGCAAGACACCAAGGAGTCGCTCGAGAAAGCGTCTGC
CGGACGAGATTACGCGCTCGAAGAGTTCGTGCGTATAACTCAATTGCGCGACAAAATCCAAGCGAAACTGGCGGACAGCGAGCTCCAGCGGGACAAGGCG
GCTACCGAGTGGGCGGATGCCAAGCGTACGCAAACGGAGCAGGAATCCAAGCTTCGCCGCACGAGTACGTGGATCCTCTTTTAGCCCTTGCTAGTAACCC
CATATTCACTTGTTATTGTCAATCCAGGTGACAAATTGAAGGAAGCCGACGCAACCGCCGCGAAACGCCAGGATCAACTCGCTGCAGCCCAAACTCAGCA
GCAACAGCTGGTCCTGGAGCACAATCGTGGCTTATCGGAGTGGGATTTGGCACGTCGACGACTGGCGCTGGTGACAGCTGCCGTGTCGGATCCCCTTCCT
CCCTTGTCGGGACCCTCTCGTGCTGCCAGCGTCTCTGCTCCTCTCCCGTCTGTAAGTGGGGCAGATCCATCAGTTGCGAAACGTCCGCGTAGTGCGTCTC
CCGCTCCTAGCACCGGATCCCCCCGTCCCCGTAAGCAAGCTCAAGCTTCCCCGAAAGCCAAACCCAAAACGACTCCGGTCTCTAAAACGGCTTCGCAAGC
GGGATCCACCTCTGCGTCCAAGGCGGGATCCACATCCGCGTCCAAGACTTCCGCTTCCCCCTCGAAGTCGGGTGCAGGATCCAAGTCTGGATATACCGCT
AGATCCAAATCTACCTCGGTGTCCAAGACTGGATCTGCCACTACGTCCAAGTCTAGATCCGGACCCCAGACTGGGTCTACGGCGTCCAAGACTGGATCCG
TTGCTACGTCCAAAGCGGGAGTGGGATCCAAGGCTGGATCCACTGCCAAGGCGGGATCTACGGCCGTATCCAAACCGGGATCGGCGTCCAAGACGGGATC
CACCGCTGGTCCTTCGGTGACGACGTCCGCCGTTCTCCAGCCCGCTTCCATCAGCCCTTCGCCGGCCCGTACTGGACCCGGGAAGGGGAAAGCCAAACGT
GTCATTCCCCCTGGATGTGGACTTGGCAGCTCGGAGGACGACGAGGATGAGGAATCCGACTGGTCCGACGGCTCAGGACCTTCTATCCGGCCGTCATCGA
AGCGTACGTCGTCCTCCGGCCCGTATCCCTTCACTCTGGGCGATGAGAACGATGACGACGACGACGACGATGAAAGCCCGCAGGATTCGGAGGAGGCTCG
AGCCGCTGAGGATGCCTTGGCGGAAGACACGCGACGGGCTCTATCCCAATCTCGATCCAAAGCCCGGCGGAGATCCCTCTCGACGCCGCCTCCACAAGTC
GCTGGCACAGCCGGATCCGGAGGCGACACTGCGGGATCCGCGATCCAAGTCGACAGTGACGGCGGATCGGGTAGCGATGGTGGGAGGGGGTCGCCTCGTG
GTGGTGGACTCCTTGGATCTGGCGGAGGGGGGGGTCGCCTGGTGGCGGATCCCCCGGATCCGGTGGAGGGGGGTCACCTCATGGTGGTGGATCTCCGGGA
TCGCCCCATGGTGGCGGTTCCCCAGGATCGCCTCATGGTGGCGGATCCCCTGGATCTGTCTTGATCCCCGCTCCCCCTAACTCGTCACTGCCCGGGATGC
TCCCCGTGGCTCCGTTCGGTCCGGATGCCGCCTTCATTCCTGGTAGACGTGCTCCTGTGGCCTTCGCTACCAGAGACATCGAGCCTTGGTCCGCCAAAAA
GTTGAACCGGGTCGCGGTCATCTCAATGAAGATCACGGTCTTGTTCCCTGAGTTGTCTTTTCGAGCTGAATGGATATTCCCTCGGGCAGCGGACGCCATC
CCGAGGGCCGGGTACGTGGATTCGCTCATCACCAGACCTCTCGTGGAAGAACTGATAAGCGCTGCCTCGTGGGATACGCTGGCCACCACACCGGTGGATC
CGGTTAGCTTCAGGGGTGATGTGCGTGGGCGACTCGGGGTATTCGTTCGTGCGTTCTGGGATTTCGTCTCCAAGTACCGGGTTGCTATATGGGAGGGCAC
GCACCGGTTCCCCATCTCTCGTAATCAGCTCCAGGGTTCGACTTGGTTGTCCAACTTCAACAAGCAGCGTGGTAACCGACGTAGCCATGCTGGTCGAGCT
TGAAAGAGAGTCCTTGTGATCCTCGTGTTGGCAATCCAGGACGCTTGGTGTGACGTGAATATTTTGTTGGATCCATCCTTCTTGCATCTTCCCCGACGCG
GGGATAAAGTAGCTTGGTTTCCGGGATCCGTATCCCGTCAAGCCAACTTGGAGGATCCCAACCTCCATCGCCCGGAACCCACGAGCCTATTGGAAGCCTT
GCGAGAGATCGACGAAGCCGAGCCTTGGCGTATCCAGTTTCGCGGGGACTTGAGCCAACACCCAGGACGCCAGATCCAGCGTCTAGTGGGCAAGTTTTTC
AACGTTCAGCCCAAGACTACCTGATCCTCATCACTCTTTGACGCCACGCCCCCAGTTTCAGTCTTCGTGGATTCATTTCGTAGCAGTAACTAGTGACTGG
AAACTGGGTCGAGTTAGCCCTTTGCATAGGCTATTATAATCCACACTCTCTTACTTGAATATGTCTATAACATTCCCTCGTTGGTTGCGAAATCTAGTCA
CCTGGATCTGGGCGGGATCCACCCTTTCAGTGTACACCTCGATCTGGGCGGGTTCCACCCTTTCAGTGTACACCTGGATCTGGGCGGGATCCACCCTTTC
AGTGTACACCTGGATCTGGGCGGGATCCACGGATCCGGTTGGATCTGCGCCTGGATTTCATCCGGATCTAGCGCCAATGACCCAGGATCAATTGGGTCAG
TATAGTTGGGGCCCTTGAAAGCTCGTGCTTGAGATCAAACAGGACTCCTCGCACGTAAAACGTCACTCTTATGCATAAACATTCACTCCTTCCTCCTAAT
CCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCTGATGTGACCAACTCACATCAGCGATCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCT
TCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATC
CCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGACATTCACGGTAA
ATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGACTTCGAGATCCACATTCTAACTATCTTCCGGTA
GGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTG
TACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCGTTCTCTAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGC
CAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCAGACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGCTGTGTCGATCC
GCTCGATCCTGTATCGCACTCCGCAGCCGTTCGTTCACCTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGT
TTCTCTTCTTTGGCTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCT
TGGGCGGTGTTCATCGCGAAGGGGAGCCGTTTTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTTGTGATCGTCT
GTACCATGCGCTCGGCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAAAC
ATAAAGCCTGGCTCCCGATCATGTCTAACCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAG
ACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTAGGCAACGAGGGGATATGATC
CATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCC
CCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCTGTGGTGTTGGAAATCCCACGTGAAC
TCTAGCTACAGATGTAGTTAGGATGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGC
ACCGGGACAAACTGGACCTTGTAAGCTACTTATATAGGCCAACCAGTAAAATAAGAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCT
CGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGCTGGAAGAAATATAAGGGAGTCAATTT
AAGCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGA
ACCCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTG
AGTGGAAATTCTGTTCTCTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATATCAAGTGAACAATGATCCGTT
ATGGATCTTCTTGCATGCCAAGCGTCGTCTGCACCGTCGCATGAGCATTCTTTAACGGTCCGCGCCCTGTACCCAGACCGGTGAACGTGTCTTCCAAAGG
TCGCTGGTGTATTCCGCGAACTCATCCCAACCGCCACTGAGGGTTCCGTACCGTAGATGTGTCCGCTGAATGCGAATCCGGGCCAGTCCATTATTAATAA
TAAGGACAGCCTGGATTCAGTGACATAGGGCCGTATCCGATATTTGTTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTAC
ATCACCCGACCGAGGGTTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCACAACCACGGAGAAATCACTACACCACAA
CTGCCCCTGTCGCAATGGAAGCCACGGTACTGGTGCCCGTTGTGACACTTCTTCATTCTTCAATTCACCATCTCGCCACCGTATGTCCAAGCGTCTGAAT
CGAGCCGTGTCCGACGCTTTTCAGCGTCTCAATCCTCGTAGACGTCGCGAACGTGAACAGCTGGAGGTATGTCAGCTCACACTTCTCTTGAATCATCGGC
ACCTTGCTCATCATCTCGCATTACTCGACTTGTTTCTCAGGAGGGCAAGGCCGAGGGTTCGAACGTCCCTCAGTCTGCTACACTTCCTCCGACAGCGGCG
TCATCAACTGGTCCTTCGGCGCTTCCTGCCCCAGACTCTTCACTCCCTGCGGTAGCTCCTGCAGCACTCCCCGTCGTCGCTGAATCCGCGGAGATGGCTC
CTGCTGCTCCTCCTGCCCCAGCTGGTGGTCCACCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTACGGAGGCATCGGTCGATCACAT
GATGACCTCGATAATTCCCGTACTTGACTGCAATGGCTCGTCACCAAGTGCAGATCAGCGTGTGCCTCCTCTCCACGGCGATATACACACTCAGCGTCGT
CTCGAGACTGCTGTTGGTTTCGATGAGGTCCTCGCTGCGATACAACCTGTTCCTGACGCGCTGTCGGCATTACCCCAACCGCGTTGCCGACTTAAACGTC
AGTTGCGGTTTGCTCAGTCCGAGGCTGCTGCCGCCGTGCGTTCGGTGGCACCCCACATCATGGCTCGTGAGAACGCGGAGACGTTCCTCAAGGCTGCAAA
CGCTGAGATTGAAGCCTTACACCACCACGTCAAGATTCTCCGCGAGTCGAACGCCAAGAACGACGCCATGCTCGCCACTGTTCAAGCCACTATGGAACGA
CACGCAGAAGACTTGAATCGTCTGCACTGCGAGGTCCAAGCTCGGGACGTTCTTATCAGCACGTTGCAGAAGAAGCTGGCTCGCGAACGCGAAGTGTACA
AGTCTTCTATTGGTGCGAATACTGAGCAGACCCGGAAGCTCCACCTCCTTCTGGTAAAGCTTGCCCAGGGCAAGTATGTCGATAACGACACGCTCAAGGT
CCTCGAGAACCAGCAAGACCGTAACACTCGCCTCCTCCAAGCGAATCGTACCCTCCGTGCACACGTGAGTCTGGCAGGGATGGATCCCGAGGTACTTCGT
CTGGCTGTCGAAGGTACGCTCTTAATGTCGCTCCTTCCACCGTGTGTTCAGCAACTAACGTTCGTTCACAATCCTTCGTGATAGGTCTGACTGCGGGTGA
GCTGGACCTGGATGCGCTGGACTTGGATCAGGAGACGTTAGTCGCTCTGCGGCGTATTCAGTCTGCCACCGCGTCTTCGGACAATCCTCAAGCCCTTCCG
GCAGCTTTGGCCAAAGCAGCTCACCAAGTGGCCCATGGGAAGTCCTATAAGCGTCTTAGACCAGGTGGCGAGGATTCAGACGACGATCCGGACGACTCTG
ACGAAGACAAGGCTCCAATCCCAACGGACAAGGCCAGTGCTTCGATGGCAGCTGCCGGTCTCGGTGATGCGCCACCTGCCGATACTTCAACTCCCAAGTC
GGCTCGTAGATCGCTGTTCGGTCCGAAGGCGTGGAAGAAGGCGGCCCAGAAGAAGCGCAAGAAACCCCGTCCTCATTCTCCTGCTAAGTCGCCACGACGT
CATATGAAGACTCGGTCCAAGTCTGTACCGTCTTCTCCAAGTTCATGGTCGCCACCTCCTACACCAGCGTCTTCCTCGACTCCCGCAGTGGTCGACCTCA
GCGGCGACCAGAGTGACGTGGACATGGGGACTGCTGATCCAGGCAGCGTCCCTTCGGTTCAAGAAACTGCTACAGAGCCTTCGGGTAAGGACGTGAACCC
TGAGGATCTCGACGATGTTCCTGTCTCTCCTGACGCGCCTTCGCCCCCGCCTCAGGGTCCACACGATGTGGTCAAGTCACCAGCTTCAACGATTTCACCT
TCTCCAGCCGACATACGTGCTGCTGAAGAGGCTCTGCGCGAGGCCGAGGAAAATGCGGCTCATGTTTGGCTCGAGTGACGAAGATGAAGAGTCAGACCAG
ACTGTCCCACAAGGCAAGTCTGCTTCGGCGTCTGCCGCGACATCCAAGGCAGTTGAAGTCTCGGGAGTGGTTTCTACAGCAGGGTCTGCCCCTGTTGAGG
CTGCTCCACTAGCTTCCGCGTCTTCGAAGTCGGCTCCGACTGTTCCCACGACTGATGTATCAAGCGTGACTTCGCCTGGCCTTTCGATGGAGATTGATGA
CGATGGGAATGCTGATGACGACTATGGAGATGACGTGGATGACAATGAACCTTCGGTGGATGACTTTCCTGATGCTCCCAGTGGTAGCGGTGATGTTCCG
CCCCCCACCGATCATTCAAGCATACTCGATGACGAAGATGTTGAAGATTCAAACAGGAACTGGAGTAATCTTGGCCCAGCTCGTCCTCCGACTCCACCTC
GGCCAAATCCTTCGCCGATGATGACTTCCCCAATCATCGTTGCCGGTCCGCCTCCTTCGCCACCAGCAAGTCCTCCCGGCACCAGCATCTTCTCTTCCTG
TTCCAGTGTCTCCTCGTCCGCCTATTTGGACTCTCGATGCTGGACCTGGACGCATGATTACGGTAACCTACACTTCGGTGCCGCGTCGTGGTGGTGCACC
GTCGGTTGAGCCATTGCCTCACCGAGTGTTATCTGGTATTCGCCCTACGGTGCCGGCTTCGTCCACCCTGCCACCGTGGGTTCTTCCGTATGTGGACATG
GAGTTTACCGATGCAGGCGCCAAGAAGTGTTTCGAGCGACTCTTGAGCTTAACGCTTCCTGAACCAGCTGGTGAGGTGACCGTGCGTACAACGTTGGAGG
GTCTCCAAGCGTTCTTTGATTATTCGCATCCTGATCACCCGTACCAGCAACTTCGGCAGCTTTATCCTCTTCAAGCTTGCCTCTTTAACACTGTCGACTT
CAAACCAAGCGTCCCCATCTCCAAGCGTGCCCCGATTGAGACCCGTCTCAAAATGATCTGGGCGAACCTTCGGGGTGACGGCGGTAAGCAAGGTGACCTC
GGGTTCGCGTTGTGGGAGCGTCTCCACTGGCTTCCGTTAGCTGGTATTGAACGAGGTCTCGCTGAAGCAGATAAAAAGGTTGGCCACGACAAGGAACGCT
TGAAAGAACTGAGAGCTATGTTAAAGAAGCTCTTCAGTGAGCGCGAACCGTCGTGCCGATCGTCTTCGTAACAAGTACCGTGAGCAGTACATGGCGTGGA
AGTCGTGACTCGGTTTCATCTAGTGCTTCCGGCGTGTCATTCATTCGTCCCGAGTTGCTTTGGAGCCGTCTAAGCCGTGGTACCCCATTGAAAACTTGTC
ATTCGCACCTCAGACATCTGACTGGCTTTCCGAAGTTCCGGCTCTCGACGCTCGTCAGCCATGGCGTACTGGATGGATGAATGCGCCGCATCAGCACCCG
TACAACACCACGTACTTCCCGTGCCAGCGTAATCCGGAGTTCTTCAATCCTCGTGGCGTGGATGTGTACCGAAGCGTGATCGTTGACCCGTCTCTCGATT
CAACCGAGCTTATTCCGACCTGGCGTTCGTTGTTTGACTCGCCACCGGGTACTCCACGTCCTGCTATGGACCGATAAATCAACTAGCTTGGCTACTTCGG
AAACCCTATATGTCTTCATTTTTAGCGAACTCCTTTCTCACTCCTACAGATTCGTTAATTAACCCCCGCTTCATTCCGATCCAGCATGCGGGTGAAGAAA
AAGATAAAAAATGAAATGATTGTTAAGATACCGGCTGAAAAAGAAATGCCATAAAAACCGGGGAAATGTGTAATTAGCAGACCGCCGGCAATGCCGTCAA
TCGTAGTCCCTAGATACATTACTGCATTTGAGAATGCCGATATCGTACTACGCATTGTAGGGGCTGATTTCTGCATAGTTACCTGAAGCAAAGGAAAAAT
CAAACCGTTAGCAAAAAAACATAACGCAAGTAAAGCCAGAGACGTTATCAAATTATTGGAGAGTGGCAGGACTATATAAAGAGCTGCAATAATCAATAAC
TCAAAAATAAACACACGCTTGAAACCCATTCGTTTGGTAATGCGGTGGCTGATCAAGGTCCCTAATAAATTACCACCTCCGAGCAAAAGCATAGCTGATC
CAATACCGCTAACTGTCAAGGTATAACTCATTGACAACCAGGTACCCGTAAATTGGGTTAAGAAAAAAATCCCCATTTGAAAAAAGAAATAGGCGAGTAA
AAACCAAAGGGCCATTTTATTTTTAAATAAACCTGAATAAACAGATTTAATAGATGAGTTTATTTGATGTTCGGATGTCAATTTTGGCAATAAAAATACC
ACAATTATCGTTAACGACAAAGCGCATATAGAAGTGAAATAGAAAGGAAACCGCCAAGAAACGACAGCCAAGTAGCTTCCGATTGGGATCCCTACTAATT
GAGAAACGGCAAAGCCAGCAGAAACATAACCGGTTGCTCGAACGACATGATCTTTTTTTATCACTACAGGAATGGAAGCCCAGATTTGCGGGGAAACAAA
TGATGCACTAATACCAGATAACAAGCGGAAAATAAGCATCCATGTAAAGTTGGAAGATAATCCGCAAAGAAAGGTTGAAAGTGCAAATGCAAGCAGGCCC
CCAATTAGAACCTTTTTTCGATCTCGTCCATCCGAGAATGGGCCAGATATAAGGGCATAACTCGCGTATCCGATAGCATAGGCGCTAACTAGCCAACCTG
AAATGGCAGTCGGGATTTGGAAGTAACCGGAGAGCGTCGGAAGTAGTGGCGCAACTAAAAATGTATCGGTGCCAATTAGAAAGGCAATCAAAAAGAAAAT
AAATGTATATTTTTTCATAACTCCACCCTCTGTTTTTAGAATCTCAAAGGGTTGACCCAGTGCGGACAGAAAAAACGTAGAGAAGACTACTGAGCCAGCA
GCTTCAGTGTGTGGGGATTCCACGCGAAGAAAGACCACAAATAAAAAAAAAACAGCAATGTATAGATCGGGTAGGAGCCTCGAAGACCAGCGCCGGTCTA
CGTGATGGTCACGACAATGACATTTGGATGCCACATAAGGCGCACAAGTCGTTGCCGAACGACAACAGCATCGCCGCATCGCGACCGAAGAGGAAGCGAC
AGCAATCCGCCTGCCTCAATAATACGTAGTGACAGAGCGTGATGGCGCAGCGCGGTGAGGATGCTCATATAATTGTCAGTCACAAGCACACGACAAGGTC
TAATATATTGAAAGAGTGAAAAGGAACCATGCAAGTCGAGATGGACTCGCAGCAGCAACACGGAACTTGGGTGCTTGCTCCGCGTACAGAAGCCAAGGGC
AAGCGTGTCGTCTCGTGCAAGTGGGTTTATGCATTGAAGAGGGACTCAACCGTCAGGATCAAGCAATACAAAGACAGGTTGGTCATCAGAAGGTTTTTAC
AGGGCATAGGCATCGACTACAGTAAAACCTACGCCCCTGTCAACGCGGATGGGCTATTTTACAATTTGACATCAAGGCCGCGTTCTTGTACGGTGATCTC
GACGAAGAGGTTTATATAGAGCAGCCTCCAGGTTTTGGGTAAGACTCTACGCGCTACGTATGCTATATAAAGAAGTGTTTGCACAGGCCAAATCAAGCGC
CTCGGGTTTGGTGTAACGGGGTTACATGGTGTGGAACACACCAGGGGTACGAAGTTCCCGGAAGAGTTAACAAACTCTCAGTACATAAGTTGGAGAGTTA
ACAAGGTCTCTCAGTACGTTGGCCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAAGAGATACATTTACCCCTAGGCGG
CTTGGCCGCAATAATAGTAAATAAAACACTTCTGGTTTTGAAGCATAAAAGTTAAGGTGTTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCCTTTGG
ATAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACCACTCCCCAGTGGAACGGATCCT
CAGCCCACTTCCGCCGCGTCGGGTCCTGAGGCACCTGGTTCGGCGTCAGCTTCGTTGGCTAGCTCGGCGATGATACTTCTTGCCACGGCTGCGAATGTGC
ATCTCCTTCCGCAAGTCCAAGGGATGACGTCTGCTACGACGCCACGCCCCCAATCGTCGAGTCCGCTGAGCTCTCCCAGTTGTCTCCGTCGGGTTCAACT
CACTTGGAATCCGGATCGCCGACCTTTTAGTTGTCTTCCTTTGACTGGGCGTCCCGTAGGTATCGTTCAGGACTTCATTTCGTAATTATTCAGTATATGT
AGTTTCTACACAGTAGCATTCCGTCTCAACTCGGCCTGTGTCGTCCGCTGAGTTGGTGTAACTTTTGGTGCAATAGCTGTTAATCCTCATCTGCAACTTG
CACCAATTTGCAGACGGGTTTTCGCGCTTCTTCTGTCGTAGAATAGTCAAACAAGGAGACCCCCACATGACAAATTCGACAGTTGTTCCCAAGTAGGCTC
ATCGTAGCCGACCCACTTAACTTTAAACTTCCGTCCTGTAGTATCGTGACGTACTTGTGGATAATGGTAGCTCATCGTCGAGAATTGCTTCGACTTCATA
CTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGATTAGCCTCGTC
TTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGCTAACTCCAATTCGTAGG
CAAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGTCCGACTTGACTTGCTCCATAAACAACCCAGA
CTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATCTTTTCTCCTT
CTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTGTCTGTTCGCT
TCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGCGTGTAGACTTGGCGTCCCAAC
CATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGTCGGCTTGAAG
TGGGTCTTCTACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTAATGACCGTTAGCTTGAGGTCGGTAACTCAGCGTAGCTCTTGAT
CTCGACTGCATCATCTCGAAGAACTTTTGGAACACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACTGCCTGAAGA
CGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACAGCAGCAGTGC
AGTATTGCCCCCGCTGAGTTCGAGGAAGGGCGAAGAACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAATAACCTT
CTCAACTGTGGCTTGCTCTTACTGGTATTGCAGTCTTCGCAGGCTCTAACATGTTTCCACACGTCCGGCGTACAGACCAATCCAGTAGTAGTCGGCTTTG
ACTCGGTGATAAGTTCTGACGATGCCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATTTCGTCGACCATGGTTGACGGTATCACCAAT
CTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTACAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGCGACTT
TGCCGGCATTCTGAGCTCGCCGGTGTGTAAGGTTCTCCACTTCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCCTTCGC
GATTCGTCGTCTCCGCTCAGTCTGTACCGTCACTGGATCAATGTCGTTGGCATTCTGAGCTGTCTGGACTGACTCCATCTGCGACCTTGTTTCGACATTC
GGGGTCGTGTGGTTAGTCCGCCGAGTCGACGCCCCGCTGACTTGTTCGAATTCATCTCCACTACTTTCAAACGCGGATTCTCCAGGATTTGTAGACATGG
CTTCATGATCCTGACTTCCTCCTCTTACTCTAGCCGAGTCTACATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTGACTGCCGTGAC
AATCGGTGTTTCCGCTGGGTTGCCTGTGACGTACAGTTCTTCGGCTACTCGGTTAATCATTCTCAGCTCTGCTTTCCTATCCGCCCCGATAATTACTCGT
CCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGATTTGAGTTGTTTCGTGA
GATCCTTGTGTCGAGCTAGCTCCACTTGCAACGTTTCCTTCTTGCATGCTTATCAACCCCCATGGAATTGCTGGATTGCAAGCCGGGAGTCACCCACGAT
AATCAAATCAGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACTC
GCAGCGATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAAACTGCCATACCCGCCGTATTTAGCCGTCTTCGCTGAGCCATCAAATGAC
AGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGCTTATTCTTACTGTCGCCGAGTTCTTGAAGGGAGGCGCGAGGTATTTCA
GGGACTCGTTGCAATCATCATCTTCCCAGTTGAGCTCAGCGGTGGCAAGCTCGGTCACGGTCTTAGGATCTGTACCACTGAAATGACCTGCGTTCTGCGA
AGCTGTTTCTTCATCCACAGCGCGTTCTAACCTGTAGCCAGTTCCGCCGGGGTCGAACACCATCGTCGCCGAGCTCGTTACTCCGATCTCAGTTCCAGTA
CCTCTCAACAGTGATACCTCTGATAAATCATAGGTGTCGCCCGCGTCAGGGCCCGTATTCGCTGAGTTCACTGCGATGGCCGATCTGGCCCCTGCGTGCT
CAAACTTGTCTCCGAGGTAGATGGTATCATCGTCGTGCTGTCTAACCACTGTCCGAACCGGTTTCAGCCTGCCATAGTCTCCAACATTAGAAGATTGGCT
CTGGCATTTGTGACCGAGGATGCATTACAGCCACACTGCTGAGTAGCGGTAAAGTGCTTGAAATGCGAGGCTGACGTCGGGGAGGGATGACATCTTTTGG
AGTGTAGTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGC
GCGCGTATCTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTC
TCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTTTGCTATCTCTTACGGCGCTTACACGACC
CCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCGTTCAATTCGGCTTGCTCCCCGTTGTCATCCT
CGTTGGCTCGAGCTCAAGTCCGAGTGGGGGGTTCGCAATTTGGAAGCTCTCGGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGC
CGCAGAGACATACGACACATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTC
CTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGG
GGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGAC
GATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCA
TAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCT
CTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGC
TTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTTGTGAGCCGTTACTCAAAGGC
AATCGGTCTCGTCGTAAGTGCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGA
TGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGT
GAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGG
TACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTG
AGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTTGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTG
CTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATC
ATGTGCGTCGTTCAATTCGGCTTGCTCCCCGTTGTCATCCTCGTTGGCTCGAGCTCAAGCCCGAGTGGGGGGTTCGCAATTTGGAAGCTCTCGGTTTATC
GTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACACATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGT
CGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCACCACAACCACACTGA
TGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAA
GACCAGGGGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGGT
TGGCGTGGTGGCTGTTGTTGAGTTATGATGCTTCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAG
CACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTT
CACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAAT
TTGGAAGCTCTCAGTTTATTGTGAGCCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCTCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAA
TGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGG
ATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGAC
ACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGT
GATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTAATAGAGCGTCAGTCTCATAATCTGAAGGTCGTC
AGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTC
CAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCAAGTTCAAGC
CCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTTGTGAGCCGTTACTCAAAGGCAATCGGTCTCGTCGTAAGCGCCGCAGAGACATACGACAT
ATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGG
CTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGTGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTT
GGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGA
GCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGGTGCTCCTTTGGCTCAGTTAATAGAGCGTCAG
TCTCATAATCAGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGA
CCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATT
CTCATTGACTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTGTGAGCCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGC
GCCGCAGAGGCATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTTGTGGCGATTCGTCCGATGCAAAATGCACCAGCTAT
CCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTC
GGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTG
ACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGGTGCTCCTTTGG
CTCAGTTAATAGAGCGTCAGTCTCATAATCAGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTAT
CTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCGTTCAATTCG
GCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTTGTGAGCCGTTACTCAAAG
GCAATCGGTCTCGTCGTAAGCGCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCC
GATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGC
GTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACC
GATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGT
TGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTT
TGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCA
TCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGTTGCCATCCTCGTTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTA
TCGTGAACTGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGC
GTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGAATGCACCACAACCACACT
GATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAG
AAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTG
GTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTCGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGG
AGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTTTACTATCTCTTACGGCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCT
TTCACTATAACATCTTAGCCATCCAATGGTGCGTCGCACCTTTCACTTTAATTTCGGGCCTTCCTCCCCGCCTGTTAATTCGGCTTGCTCCCCGCTCTCA
TTGGCTCGAGTTCAAGCCCGAGCCGGGAGTTGGCAATTTGGAATTTGGAATCTCCCAGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTTCGT
AAGCTCCGCAGAGACATACGACATAATTGCAATTTCCCAACACAAAAAATGACGGCGTTGGCGGAAGGCGGTCGTCGTTGGCGGATTTCGTTCCGGATGG
CGAAAATGGCACCCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCG
TGAAATGCGAGGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCG
GTACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGCGCGTATCTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTT
GAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTT
GCTCTATCAGCGTTTGGTATCTCTTACGGCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCAT
CATGTGCGTCTCTTAATTCGGCTTGCTCCCCGTTGTCATCCTCGTTGGCTCGAGCTCAAGTCCGAGTGGGGCGTTCGCAATTTGGAAGCTCTCAGTTTAT
CGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCTCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCG
TCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTG
ATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGA
AGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGG
TTGGCGTGGTGGCTGTTGTTGAGTTATGGTGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGA
GCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTT
TCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAA
TTTGGAAGCTCTCAGTTTATTTGTGAGCCGTTACTCAAAGGCAATCGGTCTCGTCGTAAGCGCCGCAGAGACATACGACATATTGCAATTCCCACACAAA
AATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGA
GGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATG
ACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATCTCTTGCAG
GTGATGCGTATTTTGATTAGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCAGAAGGTCG
CCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGC
TCCAATGGTGCATCGCACCTTTCACTATAGCATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGCTCAA
GCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCCGAGACATACGACA
TATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTG
GCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGTGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTT
TGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGACACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGG
AGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCA
GTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACG
ACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCAT
CCTCATTGGCTCGAGCTCAAGCCCGAGTGGGGCGTTCGCAATTTGGAAGCTCTCAATTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAG
CGCCGCAGAGACATACGACACATTGCAATTCCCACACAAATATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCAAAATGCACCAGCTA
TCCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGAATGCACCACAACCACACTGCTGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGT
CGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCATCGATACGCCTGCGGTGGTGGT
GACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGGTGCTCCTTTG
GCTCAGTTAATAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGTCTCTTTTTGCTCTATCAGCGTCTGCTA
TCGCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTC
GGCTTGCTCCCCGTTGCCATCCTCGTTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTGTGAGCCGTTACTCAAAG
GCAATCGGTGTCGTCGTAAGCGCCGCAGAGGCATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCC
GATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGC
GTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTCTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACC
GATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGT
TGAGTTATGATGCTCCTTTGGCTCAGTTAATAGAACGTCAGTCTCATAATCAGAAGGTCGCCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTT
TTGCTCTATCAGCGTTTACTATCTCTTACGGCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCC
ATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTT
ATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGG
CGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCCCTGGCATTTGTGGCCGAGGATGCACCACAACCACAC
TGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAA
GAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTT
GGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTAATAGAGCGTCAGTCTCATAATCAGAAGGTCGCCAGTTCGAGCCTGGCAGG
GAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACC
TTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGTTGCCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGAAGTTCGC
AATTTGGAAGCTCTCAGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCCGAGACATACGACATATTGCAATTCCCACACAA
AAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCG
AGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTAT
GACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCA
TGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTC
GCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACG
CTCCAATGGTGCATCGCACCTTTCACTATAACATTAAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCA
AGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTTGTGAGCCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGA
CATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGAT
TGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCT
TTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGC
GGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCATAGTTGGTAGAGCGT
CAGTCTCATAATCTGAAAGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTTCTTTTTGCTCTATCAGCGTCTGCTATCTCATTACGGCGTTTA
CACGACCCCCACAGCCTCTTACGCTCCAATTGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGCCCTGATTGC
TACGCAGCCGGTTGATTTTTTGTAGCTTTTTGACTTTCCACATTAAAATGACGGCTTGCTTTTGAAAACATTCTGTCGATTCGTCCGATGCAAAATGCAC
CAGCTATCCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATACACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGC
TGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGT
GGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGGTGCT
CCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGCTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGT
CTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCT
TAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTCTATTGTGAGCCGTTAC
TCAAAGGCAATCGGTGTCGTCGTAAGCTCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGAT
TCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTA
AAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGCTTGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACG
GTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGC
TGTTGTTGAGTTATGAT