Description :
From Genome Similarity Track
Location :
Scaffold_432:1490- 5625
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_432-snap-gene-0.6NADPH-dependent diflavin oxidoreductase
Pytir_DAOMBR486maker-pir_contig_432-snap-gene-0.11CRN domain-containing protein-containing protein

Sequence
4135 bases(100 bases per row)
GTCGCTCTTTGCGACCGACCCGGAGGAGAAAGAAAAACTCGAAGAGCTCGCGTCGCCCGAAGGTGTGGATTTGCTCTACGACTACTGCATTCGCGAGAAG
AAGACGTACTCGGAGGTATTGTTAGACTTTCGAAGCGCGAAAGTACCGCTCGCGATCTTGCTCCAGCTCATCCCATTGCTGCGGCCGCGCTCATACTCGA
TCTCGTCTTCGCCGCTGCTGCATCCTGGTCGAGTGAGTTTCTTTTTCTATTCGGGTACATCACATAATTAAGTTCTGAGCTGACTGATCTATACTGTTGC
TTATCTCTCCACTCAGGCGCACTTGACTGTGGCGATTGTGGACTTCCTGACGCCCTACAAGCGCCGTCGATTGGGTATCTGCTCGCTGTTTCTCAAGGCA
CTCGATCCTCAAAAGGAGCGGCGAATCGTACCGATGTGGATCAAGACCGGGCTGTTCAATCTGCCGAGTCGAGCCAGCCACATGCTCTTGGTTGGTCCAG
GCACCGGACTCGCTGCGATGCGCGCGATCATCCAAGAACGGAAAGTGCTTCGAGCCACTGGAGCGGTTGCTGACGGCGATGCTGCGCTCGGCCACACGTA
TCTGTACTTTGGCTCTCGCCACAAGGAGAAGGTGTGCATATGCGTCTGCTTTGATGTTGTTTCACTCTCCATGACGTTCTATCTAACTCATTTCCTATTG
ACTTTACTTTGTAGGACTTTCTATATGGAGACGAGATGCAGAGCCTAGTGCAGTCGCAGGATCTCACGGGTCTCCACACGGCGTTCTCGCGCGACCAGAG
CCACAAGATTTACGTGCAGACGCGACTTGCCGAGAACAAGGACGAGGTTTTTGCATTCCTCGTGAACGGCGGCTACGTGTACATCGCCGGGTCTGCGAAG
CGCATGCCCAGCGACGTGTACGAAGTGCTGCGCGACATTCTGCGCTCGGTGGGCGGCATGCCGCTGAAAAACGCCGAGGCGTTCATGAAGGCCATGGTGC
GCTCGAAGCGGTATGTCGTTGAGTCGTGGTCGTGAGTGACTTTGCATTTTTTTTTGTTTTCATTTCGTGAAAACAGTCCTTTTCGATAGATGGAGAGAGA
GAGATGTGGATACTAGAAAGATGCTTAGTTAAAGCATCAACTTGCAAGCGCGTCAAGCAATGTCTTAATGAGCGATTGTGTGGTGGACACCTTGACGCCA
ACGAAAAGATAAGAGTGCGCTATGGCTTGCGAGAGCGAGCAGTGTGGTCTTCTTGTCGGAATGGAAAATGATTGGGAACGCTGATTTAGATACAATCTTC
ACAAACATGACCCACAAACGGAGCAAGTGTTGAACTTCAAAGTGTAATACTGGCACAAGCATTAGGCTGTTGACTTCATAGATAGTGTTAAATACTTGAG
CGACCTGGTAGAGCCATCACATGGAGATGCCGCATAAATGGATTGTGAATAAACCAGTACACATCCTTTAGAGGAGCTTCCCGCCGCATCCGACCAAACA
CCGTCGGGCCTTTTCTCCTTGTGTACTTCATGAGCTCGGCGAGGAAGAGATCGTTGTTTGTATCGTTTTCATGGCCATCGTTTACAGCCACAAAGAACCT
GGCCAAGTGATCGCTTCGAATCACCTTCAGCCCATCGCTGTCCTGGATCACAACGTCCAACACGGGCGTCTCTGCCGTCCATGTTTCACCACCATCGTCA
TTTCTCAGCTGAGAGAGAGCGTTGGTCGTACTCTTCTGCTTCTGGATCTGCAAGCGGCACAAGCCCCCGACGAGCTTTTACTCTCCATGTAGGTGCCGAC
GCCTCCGACAAACTTAACGTCGACGGGCTGTCCAGGATCCCTTGTCAGCGCAGCGTCAAGTGCGTACACTCGTGGAAAGTCACCGCCGCCACCATGAACA
CGATGCACTGATATTCGTGCAAGCTGTTGGGGTCATAGTCCTCCTGGGCTGCGATCACGTCCAGTCGGCCGCGCACCGCTTGGTTCACAAAGATGGCTTT
CGCCTGAGTGCTTCGGTCGCTCCAGCCGTAGATGGGGTCCCTGCTGCTTGTTGGTTGCTGAAATTCGGCTGTGGCGGCGTCCAGACGGTCCTGCGTCGCT
GTGTCTGCACCCAACTGGCGTTGTATATCGTGACCGCGATCAAAGAGCATCGCATTTGCATTCCCAACCTCAATCTCAGTCGCTTTGTTGAGTGAGATAC
GGAGGGTATTCCATGGGGCGGGTTGGTAGAGCTACTGGAGCGACGCCACCGGTTGCTTGCTGGCTGGCTGAGCATTTGCGGTCTGCTGAACAGCAGACTC
AAGCCGACTGTCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGTTCGGAAAGGAAAGTGAGTGGTTGGTCTTCGCTCTTCTCGAGTGATTGTAGTAG
TGACCAAAGTGAGGGAACAATGTTGAAAAGGACCAAAAATGGACCAAGGTGGAAGGCATCAAAGTTCGTTCGTTCATTCACAGCGTGTGACTTTTCAGGA
ATCGATCTGTTTGCAGTGAGAGAAAAGGAGCCTCTCGCAATGGAAGGAGACGGCCGGACTGAGACGCTTGCGGGACAGCAGGAGAAGAAGTCCATATCGA
GTCATCATCCTCATGATGCACCACCAGCAACCAAAGAAAAGGAAGAAGAAGAGCTCGCAGTTGGCGGCGCCACCGCCGTCTTCCAGTCGCGCCTGCAAAC
CAAGCGCCTGGAGCGTATGCAGCAGCGACAGCGATCCCATCCCGAACACACTCTTCAAGACTCAGGAAAACCAGTCGTTCAACCTACTACTACTACTGAG
GAACAGCAGCAATCGTCGACCACGATTGTTACACGACCTCGAAGCCTCAGCAAGTCTGGTGCCGTGGGAACCGCCGCAACTACCACCAATACTACTACTC
CTCGTCCACACTCGAGTTACTCCCACCATCACCACCATCCATATCAGCATCAATCTGATACGGCTACCGAGTTGACCACCGAATCGGACACACACCAACA
ACGGCGAATGATGCGAGGCGAGGCGCGCCGGATCGTCATGAACTTCGGCAGAGCCGTGTGGGACGCGCTCCGAGCTCCCAGTAACGACAACCTCGAGCTC
CTGCGCTGCTTCTTCATGGTCGAAGGCGCGCCGAAACTGCTGAGCCGACGCAGCCCCGATCTCGCGGACGGCGGACGCTCGCTGCTCCACCTCGCGTCGT
GGCTCGGCGACGAACCGGTCGTGCGCTTTCTGATCGACGCTGGTGCCGAAGTGGACGCGATCGACACTGTCCCCAGCAGGACAACGCCTCTGCTCGAGGC
TTCGCGCGCGGGTCATCGGAGTATCTGTGTGCTTTTACTGCAAAGCGGTGCGAACGCGACACATCGCGATTCTCACGGAGACACGGCGTTCCACTGGGCC
GCGAGATGCGGTCACGGCACGTTGCTGCTGGAGATGGCGCTCGAGCTGGAGAAGATCGAAGGATGGGGCTCGCTGGCTGCCATGTGGACGACCAAGGTAC
ATAGATCCACTCCGGAACCAAAGTCTGGACGATGTTGATAGTCCAGCAAATCGACGGACATGCCGAACCATTATTCTCTCCTGTTTGCTTGTTTGCTTGC
TTTTGACTCTTGCATGCAGAACCTGAAGGGCAAGACCGTGCTCGAGTACGTGAAGGCCAACACGCTCGTCATGCCGCTGCTGCAAAAGCGCCTCGGAGTC
AAGTTTCCGTCGAATGCGAGCTCGGAGAAGCCCAAATCGCGGTCCCCATTCACGGTAACGCACACTTCTTTTTTCCGTGACTTGTCGATCGTCTGTTTCC
TTACTGAGCCTTGGTCTTTCCTGCTTTTGTAGACTGCGGCGGTGAGAACCTCAACGCGAGGCTTGCTCTTGAACGCGAGCGCGCGGTCCATAAAAAGCAC
TCCTGCAACTGTCCAAGAAGAAAACGCGGGCCTTCTCGACAGCCCGAGAGCGGTTGACGTGAGCCCTCCGAGTCGCGAACAGATCCTACTCACTGGTGTG
GAGACACTCGGCCTGGACGTGGCGTCGTTCGCATACAAACCCAGAGACGAGCTTGCGTCGAGGTAGTGGATAGCAGCGGCAGGCACGCTTCAATAGCAGC
AACTGCAAATGTGTAACATTTGCATTACAGCGGCA