Description :
From Genome Similarity Track
Location :
Scaffold_1575:1490- 5386
Transcript NameFunction/comments
Phyta_totarag13284hypothetical protein

Sequence
3896 bases(100 bases per row)
GAACTCCAGATGTACGCTCAAGACCTATGTCGCCGCGTTCAGGAAACCAGCAATGGGGTATGAACTGTGAGAACTGCAGAAAGCCTGGACATTCGAAGGA
GAATTGCTGGAAGGACTTGACCTGTGGGCACTGTCACGAACAAGGACATCCGACTGAGCTTTGTCGAGTACATCCATGTGAGAACTGCGGCCAGCATCAT
CATGGAATTTCGTGTGAAGACTGGGCTGCGTTCCAAGCTGTAAAAACTCATGCGAGCCAAGGCACGCTTGATGACCTGCCAACCCATATTTTGAAGCAAT
TTCGGAATGATGAATCGGACTCTGGGAAGAAGCAGTTAAACCACTAAGCCCGCTGGATGGGGATCCAGTACGCGTCGGGCTTAAGAAACCCCCAGAGTTG
TGTGCGTTAGCGTATATCAGCCCAGagctgagaagaagacaaaaCCAAGATAACCAACAATGCATGACTGTGTTTCAAAATTGATCCCCCAATTCAAGTC
AAGTGCGTCCAGACCCGCGTCTGGACAATCTACGTTCAAGCCTACCGGATTCAGGAACTCCAGTTGAGTTCAGGCTTCAACCGGGTGAGCGCTATGGATG
GTGGGAGGATCATGAACCTGAGGACACGCATGAAGTTGCAACGGTACATGGTGCGGTGAATAATGTTCGGACAACAGTCCTCCTGGATACTGGAGCGTCT
GTGAGTATGTTGAGTTTCGACTTTGCGCGTAAGCTCGGACTCAAACTCCAGACGAATAAATATATGAAGGTTTCAGAACTGGGAGGCGTCCCAACGTATA
TCACTGCACATGCCGAGGTGAAGCTCACTCTCGGACCGAGAGTGGTTTATGTGGTGAAGCTTTGGATCACCAACATTGGCGAAGGTGTGGATGTTTTATT
AGGTATGAACTTCATGTTCAGTGCGGGTGTGCGATTGTCGGTTCGAGAAGGCTTGGTTCAGcttctggatgaagaaaCTATCCTGATGTATGGTGTGCCG
TCTCGAGAGCGTCTAGGCTTGGATTTGCCTGTGTGGCCAACGGAGACATTATACCTGCAGACAGGGCGGAGTGCTATCGTGCGGATCATATATGGACAAT
CCAATCCCCAACGTGAAGTTGTTTGGGCTGGAAGAGGTGATCGGTGGGTGACCCAGATCATATATGGAGCTAAGTCCTGGCCGACTGCGGTCAAGGTTGT
AAGCATCTCTGACAAAATGACATGGGTCGACACTGGAATTATAGTGGCCAAGATCGTTGAGTATGGATTTTTCTCTCGGGCTGGCCGGTTTGTGCGTCCA
GACACGAAGAAGTACCAGGAGTGGCAACAGCTCATTTACGAATGCAAGCTGTCAGCTCAAGCTCAGATGCGGGCTGATAAGCTGGCTCAGTTGATGTATG
ATCAAGAGCCACCCTGCGTTCAGACTCCGACCTATGNATGTGTCCCGTACAAACCCGGAGAACCTTGCACGCAGGTGGCCTGAGGTGGTTAGTCAGTTCG
AAAGCCTGAACtcggatgatgaagaggatgcagTTTCAGACTTTGGGACTCAAGGATTTGCAAGTACCCCGATTcagaagctggaagaggaatACGCACG
GTGCATGCGCGTCTCAACGGAGGAATTGGACCTGAAACTGCCTGTCTACCTTCGAGAAGGCAGTGAATTGATGGCACAGTTGCGCGATCAACTCACCATG
CTACCGGAGATGCAGGATCTGAACCCTGAGTGCAagattgaagaagcagatgtCGGAGTCCAAGGAGTCTCAACACCAGAAATGGatgagaagctgaaga
agctgaagaagatcctGAAATATCTTCGCAAGATCTTCTTGGGTGACGGAAACGCCGCTCTAGCCCCTGCCCGCGGTGTGGTTTGTGACCTGGACGTAGG
AAATGCACGTCCAGTGTCTCAACGCGCAAGACAAATTGCCCCACATTTGTTGGTCAAGGTTTACGAGTTACTAAAAAAACTCCTGGAGAACGGTTTGATT
GAACTATCTGAATCGGAGTGGGCCTCACCGATATTAATCGTGCTCAAGAAAAATGGAGTGGATATCAGGAGGTGTATTGACTACCGTGTGGTGAATGAGT
TCATTAAGCTGTCACGATACCCGTTACCGTTGATCGATGATCTCTTAATCGGGTTCGAGTCTGTGATGTGGTTCATGAGTCTGGACATGGCCAGCGGTTT
CTAGGCGGTGCTCATGACTGAACGCGTCAAGCTGATCTCGGCGTTCGTTTGCCCGTTTGGACATTTCCAGTGGATCCGAATGCCGTTTGGGCTCAAGAAT
GTGCCGCTTGTTTACCAAGCAGTGATAAACAACAGCTTGTGGGGATTTGTGAGACTGCCGCCTGAGGAGGAAGCTCTAGTTGGCCAAGATGTCTTGGAAT
TTTTGGAATTGAGTACACCGGATGCTGAACGCATACAGGTTCAAGACCCCGAACGTACATGCGTTGAAGGTCTCGAACGTGGTGCGACTAAGCCCCCGAT
TTTGTCCGAAGAGAGGACAgtcttcaagcgcaacaCCCGTCGCCTCCACAAATGAGGCCAGTGCTTGGACGCAGCTCATACATTGACGACATTGCGTATC
GTGCCCCGACATGGGATCAGCTGTGTAAAGATCTGAGCGCACTCTTATTCAGGTTGAGATATTGGAACATTTCAGTGAGTCTCCCAAAGAGTGAGTTTGG
CAAATTGACCATTCTGTACCTTTCGCACGAGATCAACGCTGAAGGAATCCGAGCTACGCCGAAAATAGCGAAGAGTTTCTAAGACTTACCGTTTCCGTCC
ACGCTCAAGGGAGTCCAGTCTTTCTTGGGGAGCTTGAACTACTACCATAAGTTCATTGAAGACCTCcttgtggttgctgctgtactcTATGAGTTGACTG
ATGAACAAGTGCGCTCAGGCAGAGATCTTGCTAGAGCCAAAGAAGCGTTCGAGATTTTGAAGCGCAAAATTGTCTCAACGCCGTTGTTACGGCATCCTGA
TCGCACACGGCAGTTTATCATCATACCGCATGCCAATCCCTGGACCGCTTGTGCAGTTTTGGGTCAAATGTACGATGGTGTGATTCAGCCAGTTCGATTC
ACTGGACGCATCTTGAATGAATACGAGCTACGGTACCACATTGCTGAGAAAGAATTGTTGGCGATATTACGGATCTTGGAGCTATTTAGACCGCTAATAT
ATGGTTCAGAGTACCCGATCGTGATATACACTCGCTATTCGGTACTGAGAtggttgttgaagtcgaacTCCACAGATGGTCGGTGTCTCAAGTGGGGTCT
AGAACTGTCAAAGTGGTCGTTGGAACTTCGCCGGTTTCAgcgtgatgaagatggtCTTGCCGCAATTTTAGGTGCTGGTATCACACCCCGGGAACACTTG
GACGCAGTCGCCGAAGAGCTGATTCCGGCTAAGGGACGTGTCAAACCACCACCTGCGGTCAGCATTGAAATGCTTGAATCGGACTATCAAGGAATTGTTC
TGAGCTTTGATGGTGCGGCCAAGACTTCGACGCGACAAGGAAGCTGTGGGTGCGTCTTGTGGAAATTGCCTGGGTGGCATGTTATAGATGCACGAGGTTT
TATCCTGAACGATGTAACGGTCAACGATGCTGAGTACCATGGACTGTTGAAAGGCCTGAACTTAGCTGCCGAACGTGATGTGCAAGACTTGGTGGCGGTT
AGTGACTCACGGATTGTGATTCTACAGGCTCATGGCCTGATCAACTGCAACCAGCCTAACCTTCAACGCAGACTTGCAGAATATGAAGtcctcaagacca
agttcaAGACTATCCGATTGGTTCACGTGAAGCGGGTATACAATCAGGCCGCAGATTATGTGACGTCCAAGACGTTGGCGCTCGGTGAGTCGTGGC