Description :
From Genome Similarity Track
Location :
Scaffold_1400:1490- 4839
Transcript NameFunction/comments
Phyin_T30-4PITG_22148Putative uncharacterized protein
Phyin_T30-4PITG_22149Putative uncharacterized protein

Sequence
3349 bases(100 bases per row)
TTGGTCTCGGTGGGACTCGTGCAGGCTCAACAAACGCTTCTCGGACGTTGACTCCATTTCGCAATACTCCAGCTGACGTGTTGGGTCGACGTTCCAGCCG
AGCAACAATTGCTGCCCCATTTCCAGTGACGCCGTCGATGCTTCCTTTTCGTCGACATCTGCTGCGATTAGCTGTGGTGTCTTCGAGGTAGAGCGCTTTG
TTGGTGTCACGGGGAACTTCGATTTGCGACGTACCGACACTATCTAGCTGCCAGGTTTTCAGCTCGTCCAAGATGGCGTCGCGAGACTTGTGCTTGTGGG
TGTCAAGCTCTCGAGCTCGGTCAAGTGTGTCGGTGATGGAGATTCGTTGTGCTGGCGTCTTCGGGCGTTCCGGTAGTCCATGACTCGATGAAGGGCGTGT
ATTAACAGAGCTTGCAGAGTCCTCAGAACTGCCTCCCGTATGTTTGTAGAGATCGCGATTTGATCCCGTTGCCTCGTGTCGGTGTCGACGAAGCGCACTC
GAGACGTTTCCGGCGAACACGATGTCGGTTCCATGAGTGAGGCGGCTACCGGAGTCGTCAGCACGAGGAGAATCCACTGGAAGTCCGTTCGATGAAAGCT
GACGAGGACTTCTGAGCTCATTCGGCACCATCGGGTCAGAAGCTGATACATCGGTGTGAAGCCGATCTTGATGATTGCAGATGGCAGCGTCGATTTCTGA
GTCCGACAACTTGACTCTCTCGCTGTCCGACAGTGCCTCGTCATCCAACGACACCAGTTGTGGCACGAAATTGGTAACAATCTGACGGTAGTGTTTGACG
GTCTCAACTGAGTTCCCCGTTAGGTTAAGCGACATGAGCTGCGGACAGAACGCTGAAGCACGAGTTGTTAGTTATTGAAGATACCGAGTGGTGATACTGT
TGACTGATCTTACCGAGTTGTTCGATCTGACCAATATCCGTGATTCGATTCCCTTCGAGGTCTGAAGCACAGTACAATGAGGTAAACGGTACGCCCCACC
ATCATTCAACAGCTTTAGACAAGCCGTACCAATCACACGAAGCTCCTCATGCATCGTCAGTGGGCTGATGTCGCTCACTTTGTTGTGCTGTAGATACAGC
TCTTGCAAGTTCATGAGTGCTCCGATGCCGTCGAGATCGGAGATCTGGCAGTGCATCGCCCAAAGAACTCGCAATGATCGAAGCGATGTACCCAGATCCC
GAAAGCTACTGAGGTTGCTCTGCTGCAACCGTAGTTGTTGCAGAGACGGCAAGAGTTCCCCTATCACTTCAACCGATTGTTTCGTCGAGTCGATCGATAT
CTGCAGTGAAGTGACGCGCTCGAGGTCATGACTCCCTGTCAATTGTATCTACACCACCGAGCATAAAAACATAAGGAACTAGGTCGAAAAGAGTTATCAC
GCAGGCCTCCAACTCACTAGCTTGTCCTCCGTGATGTCATCGAATGGATTATCGAGTTGCAAAGTTTCCAGTTCTGTATCTTGCTTTTTGGGCTGGTTTA
TTATTGGGGACAGCAACCCCAATGCACTGGCACCCAATCCACCGGTAGGAACGGGCGTTGGGTTGCAATCCCTCGGCAGCGTTCGGATGAGAAAACTTGT
CTTGATGTCGGCAGGCTTTGGTGTCGGCTTCAGCTTCATGGTCGTGGAGGTAACAATCACATTCTCGTCCATTTCGTGGCGTAGATCACCCAGCACGACA
GCGCTCATGGTTCCAACGCAGAGTCACCTTTTCCGTCAATTGCAAGTGCCACACTAACCAGACCTCGTCCTCCCCAACGCATCCACTATTAATATCTCCA
AACCCAAAACACAACTGGCAACACGCATGTTGCAGTACCCAAGAATTTTTTTTATCTACTAAATGTAGCCATCCTTGCGTACCAGTATATCGGTACATTA
TTGGCAAAGAAAATGGTGGAGGACAAGAAGTCGCCGGCCATGACGCCGTCTATCGCCGCTGCACGCGAGTCGAAAGCTGAGCCTGACGTTCATGGGAAAC
CGTCGTACGTCTTTCTGCGTATAAAGCGCAAGCGCACCGACGACCCGATGGAGTGTCTGGTGGTGCACAGTGAGCCGGACTCGAAGCGTTCCAAGACGGA
CCTGGTACAGGCTTTTACGAATCTGTCGACCACTGAGAAGCGGTTCGTGTTCAAGCACATCGACACAGTGGAGGAGCCCATCACTCCAGGTCGCGTCAAG
TGGACAGAACGACTCAAACGCAAGGCACGCTCGCTCAAAGATGAACGCGCCGACATGTTGGCCAAGAAGCAGCTCGTCCCAGTGTTCCAGACAGACCCCA
CGGCCTCCAAACAGACCGAAAAGCGTGTGAAACAACAGCAAAGTCGCTCTAAAGCACGTCGGAAAGAGGAAATGCTCAAGTCCAGAGGACTAGAACCTAT
TATGGAGATCAAGGAGAAGCAGACGATGGAACTGCACGGCATCCGACTGGTAGATCTACACGTCGCGACTGCAGCGAGCACAGAGAAGGACACAGAACAG
GATATAGTAGAAACGAGCAAGACTGATGTCGTCACGGTCAACGGAGCGAGACTGAAGCCTACGCGTGTACTGAACCCGCACGAGCGCGAGCTGGATGAGG
CGATTTGGACGGCGTTCCGAGCCAACGACTTCGCACCATTCTTCCAGATCTACCACGCGCGGCGACCTGAGCTTCGTGTAGACTCGACGTCATTTCAACG
CCCAGCAGATGGAAGCTCGATACTTATGGCGGCAGCGCTACACGGACGCAGCGATGTGATCGAAGTGCTGTTGCGCTCGGGTAGTACGAGTGTTCTTCAG
CAGGATTATGATGGAGCTACGGCTGCGATGTTCGCCAAGCGTGGAGGCCACATCAATGTGGAGACAGCACTACTTGCCTGTGAAGAAGCAGAGCACGAGA
AGGACTACGTGTACGACGTTTACTGTGTTGATATTTCTGCCAGTGAAGGGCAACACGACGCAGCAACTAGAGACGAAGACGATGCAAAGCAAACAAGCGT
GAATGGTGTGCCGGTTGTGAGTGTGAGCTCGGAGGTGCATCGGTGGCTGTCAGAAGATATGCCGAGCGAAGACGTGGAGGAATACATGCTCGAGTCCGAT
ATCGATAGCAACGAAGAAGACGGGTACACATGCTTGTATAGATATCCGTGGCGCCGCTGAGGAACGGGCTTTATGTTAAGACCAAAATGCTCAGAGACGG
CGGCTCGGTTGGATTTGTGTTTTTGACGGCTCTTTTTTCTGCCTGTGGCTGGCCTGATCTGTAGATTGAGCGAAGATTCCAATGACGAGGACCACGAGGC
CAACGATTATCCAGACGAAGAGTCATCGGACGAGTCGCTGGCGGACAGC