Description :
From Genome Similarity Track
Location :
Scaffold_3100:149- 2647
Sequence
2498 bases(100 bases per row)
ATTTTCGCCCCCCTCCCCCCAGTTTCAAATAAGCCAGTTTATTTCCGGCCCTTCAAAGCTCAAGGTTGAGAACCAGCAGTTTCCTCACGCTTAAAACGTC
ACTCGTGTGAATAAACATTCACTCCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCCTCCTC
CTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCGACTCACATCAATGGATCCCCTTCCTACTCTTCTTCATGAGACTG
CATCACGCCGAATCTGTTACGACTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCGCAGTTCAGATCTGCCTCGTCTACCCCACTGGGTTCGTCA
TATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGG
CTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCATTCGGTCGGATTCATCCACCGAAAGACGGGTTTGCGGCCGGTCCGG
ATATTTTCTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGGTATTCGGTACCTGCCGATTTCCAACTTCACCGCATGTTCCCCTTTCTT
TTCGCTCACCCGGAACGGTCCGTGCCATAGATGGGCCAATTTGCGGGCGTACTCTTCCTTCACCCGATCTAAATAAAGCCACACCTGCGATGTCACTTGA
ATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGCTCGTTCACTTGGGATCTGGCTTGCCAGTAGTATC
TCTGGACTTGGTATCGCCATCGTCTTGGATATCGGTTTCTCTTCTTGGTGTTACATACCGGAATGGCCGCTTCTAGGGTGGATTTAGGATCCCACCCATG
TACCAAGTAAAATAAGGTGTCACCCCGGGATCCTGTCTTGGGCGGTGTTCATCGCAAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAA
ATCGTGGCAATACATCTTGAGTGCCCTCGTGATCGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGATGATATGCCATGATTGCTCGCTGTCTC
TGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAACCTGGCTCTCGGTCATGTCTAATCATTTCGCTAGCTCCAAATCGTCGGAAAACAC
ACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTATATTCTCTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATACTGTGTT
TCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTG
GGCCTGCCCTTGCCTGTCTCACAATCCACATATTCACCGACGTATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGT
AGGTCCGACCAATACCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAATCTCATCAATCC
ATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTGGCA
TCCTCCCGACTCAGGTCTCGTACATTCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTTAATGCGGA
CTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAACCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCC
CACTACCACCACTTCGTCCAGTCGGTTCAATGTAACGAGATCCTGACGCTCGGTCTCTCTCTCCACTTCGACACCACATTGATCCCGTAAAGCGGCACTG
GCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAAATCGTGATTCATCCAACCACGCAGGTGGATCATTACTTTCTGCCGTAACAGTG
TTAGGGCCGGGGCCTTGCAGTCAAGCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAACCTTTTCGGATCTTGTCCCTTTAG
TAAATCCAAAGCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGT
CTCCACAGTATTGCACTGTATGCTCCCCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGGCGTATAGATCCTCATCCACCTGTACCGTCGG