Description :
From Genome Similarity Track
Location :
Scaffold_4958:149- 1855
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4958-fgenesh-gene-0.0Pre-mRNA-splicing factor SF2
Pytar_ATCC12531maker-par_contig_4958-fgenesh-gene-0.1RL38, ribosomal protein 38 60S large ribosomal subunit

Sequence
1706 bases(100 bases per row)
ATGTGCGTTCTATTTCCAGGCCGCAACCCGCCGCAGCGCACGGACTTCAAGGTTCGCATTACGGACCTCCCGCGTGGTGTCGACTGGCGCGATGTCAAGG
ACCACTTGCGCTCGGCCGGTGAAGTGACATTCTGCGACGTGCAGAGTGACGGCACGGCGTACGTGGACACCTAGGCTTGTTTGTCTATCTCGTTGAGGCA
CGTACTGACGTAGCTGCTCTGGACGCTGTTTGCAGGACTGCCGAGTTCTCGACGCGCGAAGACATGGAAAATGCCGTGGCCAAGCTCGATGACAAGGAGT
TCCGTGGCTCGTACATTCGTGTGACGGCGGAAGGAGGTGGCGGTAGTGGACGTGGTCGCTCGCGCTCGCCTCGTCGGGACCGCTCCCCGGACCGTCGCTC
GCGCTCGCGTTCGCCTGGTGCACGCAACGAGGCGTCGCCGCGCCGCTCGCGCTCGCCGTCCCCGGCGGCCCACTCGCCTCCTCCGCGTAAGAACTCGGTC
TAAAATGCCAGCAACCAAACTGGGTACTACTGCATTTTCCGATCGACGCTACGCCGAGCCAAGCTGCATGTTGCGCCGAGAGAAACGAGAGGTCCGATCG
ATGCCCTCAATTCTTTTTGCTTTATACCTACTTCCGTCTGACGACAAATGACAAAACGAAAATGCCTCTTTTCCACCATGGACGATATCGTTGCGCTTGC
ATACGCGGCACCGGTCAAACCTCTGGCTGTGTGGCTGATCCTTTGCATCTCGGTCCTTGCGTAATCGCGAGGTGGCCTGGTACGCAAAGAGGACGAGTGC
TGCCGGATGCGGATAGCGGGGGCGTCCTCCTAGGGTAATCTACAAGAGCCAACGATGCCATCGAGCAATGGAGTCACAAACAACTAGGAGCGGAGCGCAC
GCATGAANNNNNNNNNNGCGCCAGTCAAATCTCTGGTTGTGTGGCTGATTCTTTGCATCTCGGTCCTTGCGTNNNNNNNNNNCGTGATCTACAAGAGCCA
ACGATGTCATCGAGCAATGGCGTCACAAACAACAAGGAGCGGAGCGCACGCATGAATAGTAGAAGAACCAAAGGCGACATCTCTTCCGACTCGATAAAAG
CCAACTCCTCCATTGGATGATGCAAACTGATTGTCGCCAGCGGCCCCGAGACAAAGCGTGGGCCCACTGGAAGACTGACTACCACTGCAACAAGACAAGC
GGATGATCGAGCCGCGGCGGAGACGGAAGAAGTAGAAGACCGTGCGTTTACTTATGCCGTAATCCGTGGGACACCTTAGATGTCCTTGCGCTGAAGTCCT
GCAATGGTGATAAGAGCGACATCAGCAATCTTGGCACACGCGAGGAGCCGTCATGAAAGCAGCGAACGTACCAGGCGGCAGCGACTGGGTGAGCTTGTCA
GCCTTCTCGGTATCCGTCACGCAGAGCGTGTACAGGTACTTGGAGCAGCGGATCTTGAACTTGACGACCTTGTCGGTCTTCTTGATCTTCACCGAGCGGG
CGTCCTTTCGGCGCGCCTTCTGAAGGAAATCGCGGATGTCGGTGATTTGCTTCGGCTACACGGAGAAGAACAGACACACCAACAGCAGTGAGCTCGTCTG
TCTCGGAGAAAAGAGAGATCTGAGCTGTCGAGTCGGTCGCGGCGGGTTCGGTCAGCAGGCAGGTAGCGTGGACAGCGCAGCACAATGGATCCATCACGGA
CACGCG