Description :
From Genome Similarity Track
Location :
Scaffold_1150:149- 1179
Transcript NameFunction/comments
g15452.t1hypothetical protein

Sequence
1030 bases(100 bases per row)
ACTCGTCGCATTCGGCGAACACCACTGCGATGAGGTTAGAGATGGGGAATTTGAAGACGCAAATCTTGTACAACCACGTGTAGCCCGACGGGATCTTGTA
CGCTGGGGGGCTGAAGCCCACGAACATCATGAATATCGAGTTGAACAGAATGCCCGTGATCTGCGCCACCTCCTCGCTCGGAGTTGCGAACACGAAGAAT
TGCGCCAAATAGACCATCATCAGCACCAGTAAGGAAGACTCGAGCCAGAAGACCACCGCTACCCAAAATCCGGTGAAGCCCACCATGTAGTAGAAGATGG
CGGTGAACAGAAGCGAGCTGACAAAGCAGTAGGGAATCTCTGCCAGCGTGGAGGCAACGAAGTACCAGAACGCGTTGTACGTCTGGGACGCACGCTCGCG
GTAGAATGATTCGCGCTCGGTGCAGGTCAACGGCATGACGCTCTGGAACACAGCCATCGAGTTGAACAGCGACGACATAAAGATCATGCCAACGCCCGAG
TTCAAGCCTGAGTACGAAGCATAGTCGTCATTGCTGACAAAAATCAAGCCGAACAGAATCGCCAAGAAGAGGGCGAGGTACATCCGCGTCAGGTTGTACG
TTGGGGTTCGCCAGTACATCTGGAAGTAGCGGGTCACCACGAACTTCATCTGCGTCATGGAGTTGGCAGCACGTTTCTTGCCAAAGACCATTTCTGGGAG
ATCAGGAGACGGAGTTGTGATGCCTTCCTTGGCCATCGTAGTTTCCAGCTTCTGGTTGTACGGGCTGTTCTTGAAGTAGCTCACGAAATCCATCGAGTCC
TCACTTCCATGACCCACACCTGCACCAATGCACTCCAGCATCCACGTAGCTGGGTTGTAGCCCTTCGGCAGCGGAGATACACCAGGGATGTTCTCAAAGT
AGTCGATCAAGTTGCGGCAGTTCTCGCCCAAGTCGCCGTAGAACGCAGTCTCGCCACCGCGCTGCAACAGAAGCAGTCTGTCGAACAGGTAAAACACTTC
AGCCGACGGCTGGTGGATCGTACAGATAAT