Description :
From Genome Similarity Track
Location :
Scaffold_65:148942- 154127
Sequence
5185 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGGGCGGGGTCACATACCACGG
ACCACCACTGCTCCGCGCTTCCCGCCAACCGCTAGCAGGCTTGTAAGGGGATATCAGTAAAGTAAGGGAAACGACAAGATTATACACCGGGGCCACCCTT
TTTCCGCGCACGGCTTTCCGGGGGGGGGGGGGAGCAAGCCCCCAAGCGTTCCGGGATCCGATCCCCTTATTGTCTCAATGCATTTACGCTTTTTGGGGCG
TACTTTGTTTTCTACAGCAAGTAATCCACACATTAACCAGCCCCCACGCTTTCACATCCTCCCCCATCAGCGGAGCCCCACGACCACGCCACCAAGCAAA
AAGTGCGATACTTCTCGATTTATGCGTGTCATCCTTGCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTTTTACGGATGACCACCGAAGTGGT
TCCTACCACACGACCCGCGTCACCGACATATAGCTGCTAGCCTTAGACCTCACATCCAGAACCACTTTTGTCGAGAAGGGAAGGACTACTAGCCCAGTTC
GTGCATCCACCAGCATTTTCAGATTAGCTGCGCAATGTCTTCACACGCGTGTTGGTCGGGAACACTATCCAGCAACAAGCAGAGGTATCTATCTTCCTGG
TCAGCAGGCCAGGAAATAGCCGCTTTTGCTACCGCGAGTCTGCTGAGGTAAAGGAAAACGACAGCTGTGAGATTCGAACTCACGCGGGTTGCCCCATTAA
CTTAGCAGGCTAACGCCTTAACCACTCGGCCAAGCTATCACCGTTATGCAAAAAAAACATAGATGTCCACTCCCACCCTCATCAGATTCAAATCAACCAA
ACCAAACTCACGACCACCCCGCACATACCGTCACGACCTGTGCTACCACCCATAGATACGGCGCATACCGCACGCCTTTATCAAATACTGACAACACTAA
GAGAGAACATCCACACTCGCCGGCAGCACAATCTTCAATCGTCAAAGCATTCAGCGTCTTTCACCTCTGCATGTCTTCGGCTGGTGGCATGTTGGCCACC
ACCTACGTACGCTGCTTATGTTCTAACCCGCCACGGATATCATCTCGTACATAATACTCTCAACAGGGGGGGCGACTTGCACGGTCAGACTCAGTGACAT
CATGCTAGCGGATCAGACAGTTGTTGCAGCTCGTAATGATATCTTCTTATATATTGTCACAGACACGATTCACACGCGACAGCAGTCTTCGGTACGACTC
TTACCCGACGCGTCGAGCAGCCGCAACACCAAGAATTCATCTGGAAGATCTGAATGTTGGTGTCTAGGTACTAGATGTGGTGGAACAATAATGAAGAGCG
GTCAGCGTACAACAGAGCGAGTATTGAGTGTGGCTACGGACAGGCTGGTCACGCAAAGTGCACAATAGCAAACTAGCAAACTAGCAAGCTAGTAAGCTGA
AGGCATCGGTAAGGAAGTAGTGAGGCAGGAGAGGCAAAAGAAGAGCCCCCAGGCGGGATCGAACCACCGACCTTTCGCTTACGAAGCGAGTGCTCTACCA
CTGAGCTATAGGGGCTTACAAAGAGACACATTCACAGCACGAGCACCGCATACACCACAATAAAAGCATACGCACGAACATGCATACATCGCACTCACCG
TCCATGCATACACCATACGTCAACTACTACATCACCGCCAACTCAGCGCATGCCACATTGCCACATCAACTCCTTTCCTTAAAGCTGCTGCGACGCATCG
GTAAGGGCTCCGCCACTTCAAACGACGCTTCGATGAGCGGAGAGATGTGTGCGAGGTGCTCGTGACGTGGTTTCGTCGTAGAAGTAAAGAAGAGTGGGTA
GAAATTGTGGATCTTGTAATGCGTATCAGTGTGTGGATGGAGTCTGCATGTGTGGACATTGGGTTTTGGTATCGGGGGAATAGCTCAGTGGTAGAGCGCT
GGATTCCAGTCCCAGCGGTCGGGGGTTCGATCCCCTCTTCCCTCATACTTTAAGCTTTTGCGCGTCCTTCGTTTCTCTGTCCGTTTTCCCACCTTAACAG
CCGCACAGTTACAATGCTCACTATCAGCCGAGCACACGACCACGCCACCAAGCAAAAAGTGCGATACTTCTCGATTTATGCGTTGCGCAGGGGCCATGCT
AATCTTCTCTGTATCGTTCCAATTTTTACGGATGACCACCGAAGTGGTTCCTACCACACGCCTCGCGTCACCGACATATAGCTGCTAGCCTTGGGCCTCA
CATCCAGAACCACTTTCGTCGAAAAGGGAAGGACTACCAGCCCAGTCCGTGCATCCACCAGCATTTTCAGATTAGCTGCGCAATGTCTTCACACGCTTGG
CCACGTGTGTTGGTCGGGACCATTATCCAGCAACAAGCAGAGGTATCTATCTACCTGGTCAGCAGGCCAGGAAATAGCCGCTTTTGCTACCGCGAGTCTG
CTGAGGTAAAGGAAAACGACAGCTGTGAGATTTGAACTCACGCGGGTTGCCCCATTAACTTAGCAGGCTAACGCCTTAACCACGCGGCCAAGCTATCACC
GTTATGCAAAAAACATAGATGTCCACTCCCACCCTCATCAGATTCAAATCAACCAAACCAAACTCACGACCACCCCGCACATACCGTCACGACCTGTGCT
ACCACCCATAGATACGGCGCATACCGCACGCCTTTATCAAATACTGACAACACTAAGAGAGAACATCCACACTCGCCGGCAGCACAATCTTCAATCGTCA
TAGCATTCAGCGTCTTTCACCTCTGCATGTCTTCGGCTGGTGGCATGTTGACCACCACCTACGTACGCTGCTTATGTTCTACCCGCCAGGGATATCATCT
CGTACATAATACTCTAAACAAGGGGGGGCAACTTGCACGGTCAGACTCAGTGACATCATGCTAGCGGATCCGACAGTTGTTGCAGCTCGTAATGATATCT
TCTTATATATTGTCACAGACACGATTCACACGCGACAGCAGTCTTCGGCACGACTTTACCTACGGCGTCGAGCAGCCCCCAGCGGTCGGGGGTTCGATCC
CCTCTTCCCTCATGCTTTAAGCTTTTGCGCGTCCTTCGTTTCTCCGTCCGTCTTCCCACCTTAACAGCCGCACGGTTACAATGCTCACCATCAGCCGAGC
ACACGACCACGCCACCAAGCAAAAAGTGCGATACTTCTCGATTTATGCGTGTCATCCTTGCGCAGGGGCCATGCTAATCTTCTCTGTATCGTTCCAATTT
TTACGGATGACCACCGAAGTGATTCCTACCACACGACCCGCGTCACGACATATAGCTGCTAGCCTTGGGCCTCACATCCAGAACACTTTCGTCGAAAAGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN