Description :
From Genome Similarity Track
Location :
Scaffold_205:1489- 3567
Sequence
2078 bases(100 bases per row)
CGCAAACAGCGTCAACCTCGATTTGGAGCACGCTGGAAAGTATTCATTAAAACCATTTTAGCGAGAATGGTAGCTGGTCATTGCCATTTGGACATTATGA
TCAATTTTTTCTTTTACATTTCTCCCGTCCGCATGAAGCCTGTGTCTGGTATCCCGGGTTGGGACGCACTACTGATCCTGCCGATCCGATCGATGCAATA
GAGGTCGCCGATCGTAAGGAAACATGGCGCATTCAATTTCGCAATATGATTCAACGTCACCCCGGTTGACTGAATCCTTGCTCCCGTAATAAGTTTAGGC
TCGTTAGCCCGTCTTAATGTCAGATCGTCATGTCCTTGAAGCGTCCACATAATCGATAATCAAATTTTCAGTTTATCTTTGATCACACATATTCATCTAA
GTCTGCTCACATCGTTCCGATCTCGACCTCCACGGATAAGCTAGTAATCCGCTCACATCCTTATACACAAACAAAGAACCTCGTCCTCCGGCATATGCCA
CCACCTAGCACATCCTTCACCCCCTACTCAGGGCTCTTCCGAATTACTTTCATGCAACTGCATCATTTTACAAAGATTTCGACTTACCTGATCCCTTTTA
AACTCCAGCAGGAGAGCTCCACATCTCAGCTCAGCCTCTTCCACCAAACTCGGATCGGGATATCCTTCCCATTGGCCCAAAGAAACTGACAATGTACCCG
CCCATAGCGAGTTTTGACCAGATTGCATGTCCATTATCATATCCACTTCGAACTCGCCCTCGTCGAGATCGCCCTACCAGCTGTCTTCTGGCAGTAGATC
TTCGTCAAAGTCGAAGCTATCTCCTTCCTCCTCCACCAGCTCGTCTTTCGGCCGTTCTAGGAGAACACTTAACCGTTGCACGATCGGAGACAGTCGATAA
GGGNNNNNNNNNNCTAGGAGAACACTTAACCCGTTGCACGATCGGAGACAGTCGATAAGGGGTACCGGCGATATCTAGTCGTACTGCGTGATCACTACAC
ATTTCCACTACCTGAATAGACTCATGCCACATATGCGCCAGCTTCCTCGCATATCATCCTATAACCCGGTCCAGATACATCCACACCTGCTAACCTGCTT
CAATACCGTGTTGGTCCAGATCTTCATGGTGTCGATCTGCTCGTTCTTGTATTGCGGCTCTCAATCGACCATTACTTAAGATCGGGATCACTGATATCTC
CTCAGGATACGATATCGTCACCTTCTTGGATCGCGATCTCGCGCTCCTGTTTTTCCCGCCGCAAACGTAACTTCTAACGTAGATTGCGGGTCCCACCAAC
GAATCAGGTAAAAAGGTGTTTCTCCTCGAATCTGATCTTGAATCGTGTTAATCGCAAAAGTGAGGCGCTCTGCGTACTCATCCAGCCCTGACGTCAGCGA
CGTACATCTTTAGTGAACGGGTCATTTTTTGCACCATATGCTCTGTCGTTCCGCTTTCCTATATTCTATATTCCGTCTATCTCGTTGTCTCTGACCCACG
ATCGGTTGAACAAACGAAAGATATCGGACATGAATCCTGGTTTTCGATCATGTCTGATAGTTTCATTCACTTCGAAATGGAGGAACACACATTTTCCATA
GTTTCCGTCAACCGTCTGCGCCGTCCGGGATATGCCAGCCTTCGCTATAATATACCCTGAGAAGGTATCGATACAAATGAGTTTGCGTCGTATTACCCTT
GAATGAATCAGGCAGCAACGGAATGTGGTCCCTAGCAACGACCTGGAAAGGATAGTTTGTAGAATACTGGGAGACTTTCCTTGGATCGTCGGACCCATTT
CCTGTGTCACACTCCAAACATTCGCCCACATAGCGTTGTACGCTCCAATATAATTCTCTCCAGTGGAATCGAGATTTGATCCGCTGGTAAGTCCTGCCTA
TCCCTAGATGGCCTCCTTCCAGACTGGCGTGGTAATGATGTAAGAATTCTCTTGTTGTAACGTCTCAGGTATTACCAGGTGCAACAACCCATCGCGATCC
TCTGATTCCTTTTTCGCGATCGGACAGAAAAACAGCAGATTGCTCTCATCGATCTCATAATCTCGCGCGATCTTGGTG