Description :
From Genome Similarity Track
Location :
Scaffold_414:148827- 150569
Transcript NameFunction/comments
Aphin_H310_13215Hypothetical protein

Sequence
1742 bases(100 bases per row)
AAAGAAGGAGCATGCGTACACAAGCAAGACGCAACTCAAGGTGAACTTGGACAAGGCGATGGCTGCCAAGTCCGCTCACCGGGAATCCCAAAAGTCGGTC
CGCGACCAGGTGAGCTACAAAAGCGTGGAAGAGGTCGACAAGCGCATTGCCGAGCTCCAACACGAACAAAACACGAAGAGCATGTCGTTGACGGCCGAGA
AGAACCTCCTCAAGGAGATTGCCAACTTGAAGCAGTCCAAGACCGTGCTTGCCAAGGCGGCGGCCGAAAAGGACAACGGCGCCAAGTTCGACGCGTCGAT
TGACGAGATCCGCGCGGCGATGAAGGCCAAGAGCGAAGAAATCGCCGCCGTCACGGAAGCGTTCAACGCTCAAAAAGCTATCTTGGACGCGCTGCGCGAC
GAAAGCAACGCCGGCGGCCGCGACAACTACCCCAAGCTCATCGAAGAGCGCAAGGCGCTCAAGGTCGAGATCGACGACATCTTCAATAAAATCAAGGCGC
TGCGTCAAAAGTTCAAGGAAGACAACGACGCGTACTTCCAGGGGCTGCGCGCCAAGCGCGAGGCGCAGAAGGCGGCGCGGGAAGCCGAGGAAGCCGCCGT
CAAGGCCGAATTCGACGCCAAGATGGCGGCCTACGAGGTCGAACTCGCCAAAATTCACCCGTACCAAGATGAACTAGACCTCTGCCAAGCCCTCGTCGTA
TACCTCGAAAAGACGTACGGCAAGGACCTCCATGCGGCGGCGAAGGCGTCGACGACGGCCGCCTCTGTCACGGTCGAACTCGACGGTCTCCAGCCGCTCA
AACGCGACGACGAAGCATTCTTCGCGCCCAAGAAGAAGGGCGGCAAGAAATTCAACAACAACGCAGCTTCGTCGAAGAAGGACGTCAAGTTGGTGCTTCC
CCTGGCGCAGCTCCAGTCGTTCGCCACCATCGAGCTCGCGCCGCCCGCTTTCGTGTCTGCGGTCGCTGACTCGATCGCGGCGATCAAGGCCAAGAAGGAA
TGGTTTGCGAACCAAACGGAGCGACCCCAGGCTGCCGCGCCCGTCGCCGCCGACAAACCGGCGTCCCCCAAGAAGGAAAAAGCGGCTGCCCCCGCCAAGA
AGAATGCCAAGTTCAACGCGGCCGACCACGGCGCGTTCCCGACCTTGTCTGGCGCAGCGCCGGCCACCGCCCCCGAAGCGACATGGAACCGCATCGCGAC
GTCGGCCCCTGCATCCTACGACTACAACGACGTCGTCCAAGGAGACGACGAATAGGTTGCGCCGCCGCCATGGTCAGCGCCGTCGCGCTGAGGGAGTGGG
TAGAGTAGAAAGAAAGTCTCGTCGTCATCGGACGAGGCAGGTTAAGTTGTCATATAAATCTCGCCGCGGACTCGGGGTTTTATACTGGGTTTTAAGAAAA
ACGTGTGTCGCATGTGGAGTTGGAACCCCGTTGGGCGCGAAAAACTCCCGCGTCTTACGGTTTAAACGTCCTCGGTCGATGAGTGTCGTCGGGTTGTAAT
TCCGCGATCCAGGCGTGCGCGAAGCCAACTCGGCGCGACACTGGATGGCCGCCGCGACGACCGAAGACGGCGCAGCACGCGGCCGCCCGCCCCTCCGACG
CAAGATGGTTCCTTTCGTCGTGGAAGAACGACATGCCCGGGCTTTCCTTGGATATAACAAGGAAGCCAGGCTCGGGCGACGGAACCACCTGTGCCAACCT
CAGTCTACCGAGACAGGATCGAGTGGATCGAGCACGGCGCTG