Description :
From Genome Similarity Track
Location :
Scaffold_327:14880- 21523
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_327-snap-gene-0.14Folate-Biopterin Transporter (FBT) family
Pytul_var.sporangiiferumfgenesh-pug3_contig_327-abinit-gene-0.50Protein AATF
Pytul_var.sporangiiferumsnap_masked-pug3_contig_327-abinit-gene-0.20Formin-homology 2 domain-containing protein

Sequence
6643 bases(100 bases per row)
TGTTGACTTTTTCAGGAAGCACACACAGGAAGACGAGCACGAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGACGGCCGAGATCACGACGAGC
ACCCAGAGATGGCGCCAGTCCACGAGCTGGGTCACTGGGTCGGCGACAATGCCGAGCCCCGAGACCACCCAGGACGTCACGACGCCAGACACGACACCGC
CAAAGTCCATAAACGACAGGTACAACGCATACGTCAGTCCGTGAACCTCCTTGTTCGTGGGGCAATAAAACGTGGCGACCACGAGCAACTGCAGGAGCGC
GAATTCCGATGTGAACGCCGTCAAGAACGATTCCACGGCGCTGAACGTGCAAATGGACACGGGCAAGTGATCGACGGCCACGAGCGGCGCNNNNNNNNNN
NGAGCATCAGCCGCGGCAATCCAGCGATCACAGAGCACACTGTGGACGCAACAAACACGTGGCGCACGTTCCGACCTGAGCACCATTTCGCGTACATAAT
GCACGACAGGAAGCGCCCAACCATGCCTGCGAGCGACATGTACTGCAGACACTCGGGCTGGTCCTCCAGCAGCGAGAAAGTGTACTGGTACCACACGGTG
CCATCTCCAGGAAGCGCAGTGCAGAGGAAGAAAAACGCCATCGNNNNNNNNNNNNNNNNNNNNNNNTCGGTAGAACGGGGAGCAGGATATCGCATTTGCG
CACGACGTCCGCAGTGAATGCGGCCCAAGACACGCGCAGGCTTGCACAGAACAATTCACGACCAGGGATGCGACCTGGTGCTGCTGGTGACGAAGATGAC
GATGAATCAACGCCACCAACACCACGATGAGCCACATTAAATGGCGCTGATGCTCCATAACGAGTTTCGTGGAGACCAAAGACGCACACAAGCGCGGCAA
GAAGCGGCATGACGCTCGTCCAGCAGATCACCGCGGTTGCCGAGATGCTCTTGCTCTTGTACACTGGGATCCCGAGCAGCAACGCGGTGATGGACGCTGC
ATTCTTCGTTCCGTTCGCGAGCGACTGAACCTTGGCGCTCGTTTTGCTCGTGGAGTCTTCGGACGCGACGTCGACGAGGAAGATGCCGAGCATGATCTGC
GCGAACGCCTCGAAGACCGAGTCGAGGATCTTGACCACGAAGGCGCCCGAGACCGACGTCACGAACGCGCCCGTGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAGAAAAGCGACAGCGCGGCGCCGACCTCGCAGAGCACGATGTACGACTTGCGGTGGTACCCGGCGATCGGGAAGTTGTCCGAGATGAGTCCGT
AGAGTGGCTTGAGGTTCCAGGGAAAGAACGCGACCGAGTAGTAGATCGTCGTGGTCGCCGGCGGCATATGGATGATCTGGAAGAGCCACTTGCCGTACGC
CGTCATGGGGAATGTCAGGAAGAACGCGTGCAAGAAGTAGAGCGCCAGTAGACCGCCGGGCACGCCCGCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGCCGCCGCCATCATGGCCCATATTGCTTCTACTAATATTGCTCTGTGTGGGGGCATTCTGAACCCAAGTGGGAAAGAGTGATGATTACGACA
TATTATTATGTCCATCATAGTATTTCATTGATGAAAACAGACACAATAGTGTTATAGTATGCCATGAAAGTGTGATAAACGGTACTTGGTCTTCAGGTGG
TGATTCATTGGTTCGCAGTCACGGCGGCCTGTGATTGGATGAAAAGACGAAAAGACATGCAATCTCTCACCATGAACGGCCGATTGTAGTGACACCAACG
AATATTGGACACCATTGCTGCTACGTGAAGCTCTCTACAGCTCTCTACAGCTCTCTCTATTAGCGGCGCTCGAGTAAAACAGCAACGATGGCGAACAACA
AGAACTTTAATGTGGACGACGCCGAGGACTTTGACGACGGTACGAAGGCCGTGACGTACGACGCGGAGCTGCCGTCGTCCGACTCAGAGAACGAGAACGC
ACGCCTCACGTCGTCCCGCAAGCAGCGCATCCAGTCCAAGAAGATCAAGCAGCGCNNNNNNNNNNNNNNNNNNNNNCAGGCGTCGTCGCTGCGTGTAAAG
AACTGGGAGGCGGACGATTTGAACAGCAAGGAATATGCTGGCAAGGTCGTGCAGCGCAGGCAAATCAGCGGCAGCCAAGACGATGAAGAGGAGGACGACG
ACGACGCGATGGCATCTCCGGATGAAGCCGAGATGGAAGAATGGTCCGAGGCCGAACCATTTGGAGAATCGGAGTCCGAAGATGACGAAGAGCAGAAGAA
CGATGATGGTGATGATGATAATGAAAGTGAGGATGATGAAAGCGACGATGGTGGCGACAAAGACGCCGAGAAGCTCATCCGCAGCTTTGAAAAGGAAGAC
TCGGCGCAGCTCATGAGCTCCAAGGACAGCGAGAAAGTTGTGGAGAAGGCGGTTCATGTGCGCCACCAGAAGATCTTGTGGGAGCGCTGCTTGGAAGTGC
AAATCTACACAAAGCGATTACTTTCGACGACCAAGACAGTTGCGTTGTCTTCGGACCAAGATTCGGACGACGACAAAGAAAAGAAAGCGCTCGTCATCGA
CCAGTTGTACTCGTGCATTGACGCGATGTCGAGTCTTCAAGATAAGTTATGCAACATCCCTGAATTGTCGTCCCCTGCGGATGCCGCTTCCAAGAAGCGC
AAGCGCACTGTCGCGGACCTCTGGAGCCACGTTCAAGAGAGTAACCAGGCGATCTTGCCTCAGTACAATGACATTCTCAACACATACACGCGCAAGACGA
ACCTTGCGGGCGCTGGCAGCCAGGCTAAGAAGTTTAAGGCCGTGAACCAAGACATCTTGTCGCAGGTCGAGTCGGTGCTCGCGGACGTGCAGCGTGTCAA
GCGGAAAGCGCATGCACCTTTGGAAATGGATGCCGAGAATGGAGGCACGACGACTGCCGAAGAAGACGACTCGGGCGACACTGATCGTTTGGATGAGCTC
ATGTACGACGACTCGGATTTCTACCAGCAGCTCCTGAAAGAATTCCTGGAAAGCGGTGGCGGCAGCGGCCAAGACGCGCTCCTGCAGCGCACGCACCGCA
AGAAGAAGAAAAGCGTCAACCGCAAGGCGAGCAAGGGGCGCCAGCTTCGATACACTGTGCACCCAAAGCTCGAGAACTTTATGTTCCCAGATCCGTACCC
GAAGCCTGAGATGGATGTTGACGAGCTTTTCCGCTCCGTGTTTGGCCAAGTTTCTTCGACAGCGTAGAAGGATAGCGTAAGGAGATAACGGATGTACGGC
GCGAAAGCCTGTAGACAGCGAGGACATATTTTAGATAAGTATATCAGATAGCAAATGCGAGTTTGCTGGTTCATAAAGATAACGGCACTGACTGCATCCT
CGCATTTTATGATCTCTGACAACATGTTCTTCACATTTGGTTTCTAGAAAACGCGACGTGTTGTTCAAGATTAATCGTTTTGCTCACCACGTGTGGCGTT
GTGCATGCATTCGTTGGCTAGAGCAGCGATGTCTTTCTACAGAACGTCGTCCTCTTCTTCTTCCTCCTGTTGGCCTGTGATGTAAATCTCCTTTAATTCA
TTGACCTTGGTTTCCACGGCCGACAGGCGATCGTTATTGACCCCACACGCGCCTAATTTCTTCACAATGCCAACAAGTTGGATGGCTTTTTCGGCTACAT
GGATCGTCGTGTGCGCACGAATCTTCTTCGCACGAGTCGCAGTTTCCAGCAGGCGAAACTCTTCTTCAGCCAGCTCCATCGCTGCATCCGCTAGCACTGT
CGAGGAGTCAATGAGCTCAGTGCCCCGTTCGTCGAAGCTTTCCGGAATGTCATTCTCTCGCAACCGCCGCAGCTCAGCCGCATACAAAGTGTTTTTAAAT
ATCTTGTGCTTCAGTTTCACAGAGTCTTTCAAAAGCTGCGTAAACTTGTCAATCAGCTCAGGCTTGTTTTTCATTCCAGCGCGGAGCGTCACAGGTGCGT
TTATGATCTGCGCGCGCTTCGCAATCAACTGGCCGGCATCGCGGTCCAGGAACGAGAGCGACCACAGGCGGTTGTACGCTTTGCCGGCATCGAGACGCTC
TTGCTCGGAAAAGTACCAATCCCGAGTGTCTTTGTTTTTGATCAGCAGTCTGATGTGAATAAAAGATAGCGATCAAATGGTCATCAACTCCAGATGCAAT
GCATAACAAGATGACACGTAACGCATGGGGCCGTACCTTGCAGACCACGTCTGAACGGCATCCGCACCTAAGGAAAGGCCCAGTGCTTCCAGTTTCGGAC
ACATCTCGTTATAATACTTGATTGCTTCTTCATCAGAGGCCAACTTCTTCGCCAAGAGCTCAGCAATCATGCGATTGACTTCGTGGCGATTGTCAACGAG
CTTCTTGTTGCTTTCTTTCCGAGCCTTTTTCTCGAGCTGCTCGATCATGCTCATGCCTCCAAGCCCCTTTGTCGTTTGCTGCTCATCACCAAAAATGTCA
TCAATCGCACTTTCGGCGTCGGCGAGCTCACGTGCCATTTGATCTTCCACTGAGCGGTGCGGAACAGCAAATCCCTCGCCACTTCCACTTGGACTTCGGC
CGGACGAATGCATACCGCCACCACTAGACACTGCAAGTAGCAAATTTAAGGGAGTTGAGTGAGTAAATTAACAAGAAAAAAAGATGGCAGCGCTTTTGTT
TGCTTCGAACGCACCGTTTTGGATGATCTGCTGATGTTGCATTAGAATACTAAACAGTTGCTCCATTGACACTGGCCCTGATGTTCCATTGACTGCGCCA
GAAGTTGGTGGCGGTGGCTACATTCACAATAACAAAAGGTGAGTAGAACGGAGCACTATGCAGCTAGAGTGAACATGGTCACACGTACTCCTGGATCGTT
CGGAGACACGTCGTCTGGTCTGTCCAGAACCGTCGCATCCATTTGCTCTGCCGACATTTTCAGCTGGACTTGCTCCAGAGGCATGCCCATTTGAAGTAAT
TTGAAGTATTTTTTGAATGCTGGGTCGTCTTTGATGAGAAGCGGGACGTATGGAGGCGACGGAGCAGCAGCTGGAGGAAGTATTCCCGCTGAGAAAACAG
GCATGCTCATCCGCATCGCGTTTGGGTCTGGGTAATGGGGCATGTCAACTGGTGGTGGCGGCTAACAAATATGCCAAAGCGATATCCACGAGACAAGATT
GTAAAGTCGATGAGTACAGCGAGCAAGACAAAGTGAAAGCAATCCAACGTACCCCGGGATCATTCGGTGACACTTGAGTCGGGTGATCCAGCAAGTCCGG
ATCCACGCCATCCGCTTCCATTTTCAGTTTAATTTGTTTGATGGGCATGTCCATGCTTTTCAGCTTAAAATACTTCTTGAACACTGGATCATTGCCGACT
GAAAGCGGAATGTAGGCACCTGGAGCTGGCTGTAGACCATAACACAAGTTAGACGATAAATATGTCAGCGAAAAAGATCATTGAGGAATGGCATCACGTC
ATTGTCACGTACCCCTGGATCGTTTGGTGACACCTCATCAGGCGTGTCTAGCAGCGACGGATTCACACCATCACCTTCCATTTTCGCTTTGATTTGCTCA
GTGGGCATCGCCATATCTTTCAGCTTGAAATACTTGCGGAACTCGGGGTCATCTTTGACCAGAAGCGGGCGGTAGATACTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCGCGCCACCGACGGTTCCCACCGACATGTTTTGTGTCTTTTCCTCTAGTTCTTGCAGCTTCTTCTGCAAATCTTTGATATCCTTAAG
CTTCACTGGCGCTGAGCTAGACATGGTGCGATCTCGCACGGACGATGGCTGCGAGGTCGCTTTCGATTGAGACTCCATGAGCTGCGCGATCTGCTTCTGC
AGCTGATCAATGGTTTTGTTATTCGTGAACGCCTCAGCTTTGGACGAGAGTTCCAGCAGCTTCTTGATTTGATTTTCTGTCAGTCCAGGCACTTGAAATC
CGCCGCTGCCTAGTCCGCTTGAGCGGCGAGAACTCGCTGACCCCGATCGCGAAATTGACGCGTGGGCCACATCCTCGCTCTCAGAATCGCTTTCTTCTTC
TTCGGACGAGTCTTCCTCCTCCTCACTCTGTTCTTTCTGCATTCGTGCTGTCATATGCCATTGAATTAACACATTGGGCATATCGAGCATGGAACAAAAA
AGAGTGTGACGATAAAAAAGATCATTGTACCTGTGATACAAAACGCGCGATGCTGCTGTGCATTGCGACGCAGACAATTCTGCACACACGGCCACAAAAG
CCCACATGCATAAGGTTAAGATTACACCATCAGGTATATAAGACAGAGCACATACATAACCAGTATTTCACAATGTCGTGGCGCGTACCTGGCTGCAGTA
GTGCGCCGAGTGGCAGATGGAGCAGACGACTGCCGCGTTCGGCGCGCCACAGTGCACACAGTCCTCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCGCGCCGTCATGGCGCTCGTGAGGCGGCTCATGAGCTCGTCGTCGCTGTCGCTGTCCGCCATTTCGCGCTACGGAGCAAGGGTGTCCCGATGCGTCTT
CTTCTCTTGGTCGCGTTCCGCTTCGAGGCTCTTGTTGATTTCG