Description :
From Genome Similarity Track
Location :
scaffold_114:14878- 17805
Transcript NameFunction/comments
Pl_109430histone acetyltransferase, putative
Pl_109431conserved hypothetical protein

Sequence
2927 bases(100 bases per row)
ACACGTATGGGTTCGTCTCAATGGCCAAGCCGTTAGGTCCCGCGCTAGGGGGTTTCTGGGACTCGTAAGCCCCGATCACAGGGTTATAGAACCCACACAC
TTGATGAAGCCACCGATCACACTCACCGCACTTTACCCAGGGCTCCACACCAGGCTCGGACTTCTTCTTAATGAGAGAGTCCATTAAAGCGTCTGTGTCA
TCATCTGCATGATCTGAGGAGTTGCGATCCCTCGCCAAACGAGTTCTACACTTTTGACACCAAACCCGGGTGCCGTCCTCCGAAATAAAATAGACTGAGC
CCTTACGGATCTCAGTGCTACAGCCGGCTGAGCACTGCAAATGAGGTGGAGTAACGTCCAAGCATTGCTGATTGCATACGATGCACGTGTTCCCACGACA
CACCAGACACACATGTTGTACGCGTTGGCGCTTAGCTTGTCGATTTTGTTCGGCTTTTACTGATTCATTGAAGCGATTCAACAAGATTTCGGCATCGATG
TGGATGTAATGTGAGTCGGGGTTGAAAACCATCGCATTTTCGAACACCAAGCGGACGTCTGAAACAAAATCATCTAGTTCGAGATATTCTCCAGCAGCAA
GATTGCGCTTGATGGTGCCAAGATCCATTGGATGCTGCACGATTGTCGTATACGTAGGTAAATCCAGAGCAACCGGGTCCACGGGCGTGTTAAATACCCC
GTGACGATTTCGCGGGTCAGACATAAACTTCAATAAAATATCTGTCATCTTCTCAAAACTTGTGAAGCGGCCCTCCCGACGAACTGATGCAATGTGCTGA
GCGATCTCGTCCGCAGTCATCTGCAGCATCGGATTGACTTCTACAGGGTCTATTGTTTGTGGTCCTCCATTTGCAGCCTGTTCGCCAAGGCTGCCAGGTG
ACCGCCACCCAATAGGCAAACTCCGATTATCACCAAGCGTCCGGCAATCGAATGGTAGAGGTTCCATGAGTTTATGACTGATACTCTTCCCGGACAAGTC
CTTGGCTCGCACAACCTGGCGCGGTGTCACTGACGGCGTGCCGATCTCGCCGTTCCGCCGTCGCTGTTTGCGCGGTGAGAATCCTGCAGATTGAACATAC
CCGTTGCTTGCAGACACTCCATCACTGTGCGTTGCACCAAGAGGGCGTTTTCGCACTTCTCCTCGTGGAGATTTAGTTTGCACCGTCTTGGTGCTCTTTT
TAGGGCTTTTAGCGCTTGGCTTTAATTGCGCTCCCTTTCCTGCTAATCTGTTCGCTAGCGCAATAGCCCTCTCTTCTGGTGTTGCACGTGGAGACATGGG
TTCTTCTTTGGGAGCAATTTCCATACTATTAATCACCGGTACGCAGAGACTGCGTCGATGCGGTTGTTTTGTGGCAAACTGCAGCGGTCGCACTGTGATT
GTGATGGGGCGTGGCAATAAATCTGGTCGAGGCATGGGGCCTGACCTCCGACGATGTGGAGGCACTGGACAACTGAAGACAATTTTCGTCCACTCGGACT
GCACCAACCGTTCACTCGCCAGCCCTGCCTCCAGTGCCGATTTGAGTTTGCACCATAGTAAATATTTGACGAATCTCGACAGGAATTCATTTGCTTCACC
CACACCTGTTGAAATGAGCTCTGTATACAAGAAAAACAATAGGAAATAAGTCATTACCCACAGTCACGTCATCTTCAAGCACGTACCGACAATAAGTCGG
AGAATATTGGCACTTGGCGTCTCTCGATCGCCATAAAACAGCAGAAACGCTGCATCTTCTTCATCCAGTCGTCTTTTCCTCACTCCAGTGACCGAATGCT
GGTCCCACACCACATTTTCTCTCGTCGCCACCTGCCGTTGGTGTTTCTTGCCGTCCTTCTCTTCCCCTTGTTCCAGCACTTGGACATGTACCGACTTGTC
GTCTTCCTCCTCTTCACTACTACTGTCAATAGTAAAAATCTCTGGCTCCACCTCCTTCTTCACGTCCGAAACGAGCGGAATCTCTTCTTCTTCTTCCTCC
TCCTCGTCGCTGCTGATACTGATGTACACTTGGCCGTTCTCCTCCGTCTTCTCACGCCAATTGACAGCCAACGGCCGTTGGATCGCACGTTGGCGCTCCG
CCTCACGCTCGCGACTCAGACGCGGACACGCCAGGAGGCGACTCGCAGCCTCGTGCACTTCCATCGAGTCTTTCCCGCCCATACAAAAAGCAGGTGCTTT
TCATTGGCCGAGGAAACGACGCGAGTGATTGGCTGAATCTCCGTAAAAAGGATCTTAGCGAACATGGCTACTGTAGCCATCTCTATGAACACTACTTGAT
GTGCATCACTGACAGTTGAATTGTTCTCCATCGTCCGACTGATGGGAGCGTTGGCAGTCGCTTCCCGTCCTGCTGCGGGTCTCAGCTACTCGTCCCAACC
GTGACGACATCGATGCCTTTCTTCACTTTGTAATTTGCTTGGAGATGCACATCACTGCCACGACTCCGAGACCGACGGTGCCCAAGCGCGAGCCGCATTC
AGATCCGAGTTTCCAACTCCCGGACCTCGTGGCAGCCAACGGAGATGCTGCAACGATCGTCGGTTGGCCGTTAGCACCACCTCCGAATCTTCTCGGTCCA
GTCTCAGTCTCAACTGCATCTCCAACGAAGACATCAGAGTCTGTGACTCGATCTGGTTTCCAGTCTACCAAGCGACTCAAGTGGACACGTCGACTAGTGA
TCACCAAGCAACCAGCTTCGGAGTTCTACAAGGACGAAGGTGGCAAGTCAAATGCACTGGAAGTCGAAGTGACGCTAGTGGAATTCAATGAGCTGGGAGA
ACCTGCTCGATCTCCGGACAAGGAGTTTATTGACATTCCACTACGTATTCTGCTCTTTTTTGAGTCGGGAAAGAGAGTGGATGATACGGACCAGGAGATC
TTCCGCTTCGTGGGCAATGACTACGAC