Description :
From Genome Similarity Track
Location :
Scaffold_51:14878- 17669
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.4DEAD/DEAH box RNA helicase

Sequence
2791 bases(100 bases per row)
GTCGTGACTAAATGGCGGCCTTCCCGCTGCCGGAGGGCTTCTTCCCGCCCATGGCGCTCTCGGCGGACGACGCCGCTCGCTACCGGCGAACGAGTAAGGA
GCGAGTCGCGCAGCTCGTGCGCATCCTCGAGGACGCCGAGTGCGCGTACCAGTGGACGGCGTTGCCTCCCAACGCCGGTAATGGCGGAGTATCCCGTCGA
GCCTCTCGCGTGGCGGCCTCCCGGCCGGTCGTGTGCCACCGCGCGCAGTTCCTGGACCTACGGCCGACGAGCAAGGCCGCGAGCGCGTCGACGCTGCTCA
AGGCGAGTGCGCTGGTGGCGGACGTGCGCGCGGACGAGGTGCTGTCGGTGGCGGCCAAGAGCTCGACGCGCGAGTTCCGCCGGCTCATGGCGACGCTGCT
CGGCGCGACGTTCGTGGACGGCCGCACGCTCGCGACGCTGCCGTCCTCGGGCCGCTCGGCGGTTCACTCGCAGGCCGTGCCGCACTACCGCGCGATCAAG
TGGCACTGCCTCGAGACGGCGAGTCCGCCGACCAAGCTGCTCGACTTTGTCTACCTCGAGTACGCCGGCCGCCGGTCGCCGCGTCCCGGCTCGAGCTCAG
TCGTCGCCTTCTGTGTGCAGACTGCAGTCGAACGACCGGAGGTTCCTGTTCTCCCGGGCGTCGAGCGGTGCTCGCTGCCTCGCGTCGGGCTCATCGTGTC
CCGCGTGCCTCACCAGCGGTCGACGTGCCGCGTGACGGCGCTGTGCCAGCTCGACTCGCCCAGTCCGGAGCTCGCCGCGGTCATGCAGCGGTGGGTCGTG
GCCAGCATCTCGCGGCTCAACGCGCTGCTGGAGCGGCAGCGCGTCGGTCGTCTCCGGTTCGTCGAGCAGTGGCAGTGGATCCCGAACGGCGAGCGGCAGG
CGTGCGCCGTGTGTCTCCGCGGCTTCTTCTTCCACCGCAAGCACCACTGCCGCACGTGCGGCGAGGTCGTGTGCTCGACCTGCGCGCCGTTGCGAGAGCT
GGAGGAGCCCATCCTGGACATTCCAACGCTGCGGGTGTGTTCGGCGTGTCTGCTGTCCGCCGCCGCCCTCCCGACTGGCGAACAGATCGAGCAGTCCCGC
ACGACGTCGGACGACAGCAGGGCCGAGCTGGTGAGCCCGCGACACGACGAGTACGAGGAGGTGGACGTCGCTCTGCGCGGACGAGCACGACTGGGCCGTG
CACTCCGGCCGCAGGACAAGCTGCAGGTGCTCACGAATGTGGTGAGCCGCATCCGCGACATCCGCGACACGATCGACCTGACGATCGCCGAGGTGGACGA
GCGCGAGCCGAGCGACGCCGCCGAGGCTGCGAACGCGCGGCCGGCCATTGAGCGCGAGCACAGCGAGATGCGGTCGATCCGGGACGCGCTCGAGTCGTCC
GTCTCGCGGTTCGACGCCGCGTTGGTGCGCGCGACGACCGGCGACTCGGAGATCGAGCGGTCGACGGCGGACCGCTCGACCGACGACGAGTTCCGCTCGG
TCGCGCGGATCACGCTGGCGGCCGCCCACGCGACGCAGCAGGCCGGCCAGGCGTTCCTCTCTGCTGGTCGAGCGGGTCGAGCACCGCTGCACGCAGACGA
GGATAGAGCTGTTCTACCGCCGCCGCTGTACCGCGAGGAGTCGAGTGCGTTGCTCAGCTCGGACGACGAAGACCCGTATTCGGCTGGCAACTACGAGAAG
CTGCTCGCGCGGTCGACGTCGGGCACGGGAACCGACACGGTCGAGCGGCCGAACACGCGGTCGACGCAGATCCGCGCGCTCGAGGAGCAGATCCGCGCGT
TGCAGCTGAGCCTCGAGGACGCGCAGCGGAAGCTGTCGGTGATGGAGAATGACCCGCTCGACGCGCCGTTCGGCAAGGAGAACGACCCGCTGTACTTCCA
CAAGGAGAACGCGCGCGCACTGTACCCGATGTACCCGGAGGGCGACGAGCTGGTGGCCGAGCTGCGCGGCGTCATGACGGACGAGCCGTTCGCGGACGTG
GTCGCGTCGCCCATCGCCGCATTGCCAGAGAGCGAGAGCGACTTTGGGTGGTCTCCGGTCAAGCTGACGCCACCGTCGCGCTCGCCTCGGCCGACCAAGC
CGCGACTGAGCGGCGCGACGGCGTCGTCCTCTCCTCCGTCCTCGCTCTACCAGCAGCGGCGAGTGGTGACTCCGCAGGCGCTCGGCATCTCGGACAGCGG
CGAGCCCGACGACAGCGACGACCTGGACGACGACAGCGACGACGACGACAGCGAGCGGTTCGAGGGCGAGCCGCAGTTCCGACCTCCCCCGTCGGCGATG
CCGCCTACCTTCTACGTCGAGGAGAGCCTTCGTCCCGCGGTGCCAGGCCGTCGTTCCACCGCTCGCTACTCTGCTCGTCCACGCAGTGCATCGCTGCCGG
GCGTCGATCGGGAAGAGCGACCAGTCGACCGGCCAGACCAGAGCGAGGACGGTGGCACGAGCGGCCCGACCGCGCTGTACGTGGACCACGCGCTGCGTGC
GCTCCGCTCGACGCTCGCCGCGCTGCGGTGCGAGTGTCCGTCGGCCGCAGACCGCCGGCGCAAGCTCGCGGCGGTCGTCGAGGTGCTGAGTGCGCTGCGG
CGCGAGGGCGTGCGGTCCCGCTACCGCACGCTGCCGCACGAGGAGGTGCACTACGCGGCTCTGATGGAGAAGACGCCGAGCGTGGTCAAGCTGCTGCGGA
TCGCCGGGTACGTGTCGCTGCCGCACTACCTCGTGATGCGAAGGGTGGATCCAGAGTTCCTGGGTCTGGTGTTGGCCGAGCTTGAGCTTGA