Description :
From Genome Similarity Track
Location :
scaffold_15:148752- 152798
Transcript NameFunction/comments
g921.t1hypothetical protein

Sequence
4046 bases(100 bases per row)
TTGAACTCATAAAGCAGGGCTCCACAATTAAACTTGGACAACGGTAGCCACTCAGTCTCGTCGTAACCTTTCCACATCACAAGATACTCGCGAAGTCGTT
TAGACGTTCGAGTTCACTTGCTCCAACGGGTATCCAGAATCTTCTCCACTTCGTATTCATCATTCTCTACATCTGGTTCCCAACTGTCTTCAGGAAGCAA
GGCCGCTTCAAAGTCACCATCTTCAGGGACATCAATCTCCTCAGTCGGACGTCTGGGGAACATGGTTCTCGGCTTCAGGCGACTAACAGGCACCCAGGGA
TTCACGCGGTAACCAGTATCCTCAACCTTCAGTCGAACGCGAAAACCATCCAGCATTTCTTAAATCCGGAAAGGCCCGTGCCACATGTGCGCCAGCTTGC
GACTCAGACCCGTTTGTACCTTAGGGATGTCGAGCCAAACCGCATCGCCGACAGCAAATCCAGACTTCAGACGCTCCGACAACTCATTCCACTTTTGAGT
CTGTATTTCAGAACGTTCACGCTTCACCTTCTGCTGAAATTCCTCGGCGCATGCTTGAGCGTAGCTGTCTCTCGCTGCATCTTTCGACGCCACTCGTACG
CAGTACGCTCTTGGATCGTCGAGGGCTTTGGTCCCAACATCGCCGACACAGTTCCATGTGCATCCCACCCATACGGAACGGGGTATCCAAACGTGTCGCG
TCAAAAGAGGTATTCAGAGCGAACATCAGGCGCCCAGCATGATCGTCCCAATCGCTCTGTTTCCGCAATATATGCCTTGATCGCGCGCACCACAGTCTGA
ACAGACCTCTCCTGTTGGCCATTAGCTTGTGGGCGGTATCCCAGAGTCGCACGTTGCCTAGACCCCGGAAGTTCTCTGAAACACTTGAACACCTCACTCA
TGAACCGTGGATCTTGGTCGTGGCGTATCTGAGAATTGGCTCCAAAGTTTCTAAAGACATGTTCCTCATACGCTTCGGCCACGTCCTGCGCAGTGGTGAC
ACTCATTAGTTTGCACATGACATATCCAGAGAACATATCCTGAAATAGCAGCAGGAAGGTATTGCCTCTGGCGGACTTCGGCATGTGCATCACAAAATCG
ATGGACACCACTTCAAACGGTCGACTGGGCTCAATATTCCCAGGCGAAGGTCCAGGATTCGGAGGGCGCCCCTTGCCGCTGGCACAATCCACACACTCTT
TCACAGATCTCTCGACGTCAGCGTACATGCCCAGCCAGTAGAATTCTGAACTCAACTTCTCGAATGTCCGCTTGATTCCCTGATGACCACCTTGGTAGTC
TTCGTGAGCGTAGTGCAGTAAGTCTGAATGCAGATCTCTGGGAACCACGAGTCTGAGTTCATCGACCATGTCTCTCGGACGTTCTCTGGTGGCACGACTC
AAGCGATACAGCACATCTCTGGAGTCCAAGACAAAATCTTCTGCGGCTCTCGCAAGTTTTCTGACTCGTGGACGTGGTAGGCCTTCCACGTCGACTTTCA
GATACTTGATGAGTTCAGAGAGGTATGGGTCTTGACTCTGATGCGCCTTGATTCGTCGCCATCGTTCTGCTTGGAATTCCAGAGGGCCAAGTGGACCGCG
ATCTTCATCCTCACCAGGCGGTTCAGGCTCTTCTTCAGCTCGGGCACGCGTAAGGGCAGCGAACACTCTGGCGGCAGTTGGAAGCGGTGCAGACTCAGGC
CCGGGCGTTTTGGACTCTGGAGTCACAATCGAAGTGCTAGACTCCTGTCTTTCAGACGTATGAATTTCAGACGTCGTGACCTTCCGAGGCTTCATCAGCT
TTTCGTGGATCTTGGACACTAACTGCAAGTGAGTGAGCACATCGGCATCTTCCACCCGCCACGATTCACCAAGTACCAACGTCTTCGAGGTCAAGTAGTC
CGCAGCCTGGTTGTATTCGCGCTTCACATACACCAACTTCAGAAATTGGAACTTGGTTTTCAGAGATTCGAACTCGGCTAGTCTTCACTGCAGTTAGGCT
GGTTGCAGTTGATCAAACCTTGAGCCTGCTGGATAGCAATACGAGAGTCTCCCACTACCACAATCTCCTGAACACCACGTTCCAGCGCCATCTTCAGACC
GTTCACAAGTCCACAGTATTCAGAGTCATTCACAGTGACGTCTTTCAGAGTGAAGCCTTAAGCTTCCAGGACCTTCCAGCCAGGGTGTTCCCAGAGTATG
CATCCACAACTTTCCAAACGCGTAGACGTCTTCGCAGCTCCATCAAAACTCAGAACGACTCCTTCGTAATCAGCTTCTAACATTTCCACACTGATCGGCA
CCGGCGGCTTGACACGCCCCTTGGCTGGAATCAGGTTTTCAGAAACTTCATCAAGATGTTCAGGCGGAGTGATACCTGCTCCAAGTATGGCCGGGAGCCC
GTCCTCGCCACGTAAAACTCGGCGAATCTCCAAATTCCAATGTGATAACTTCAGACCCCACTTCACGTTCCGGCCGTCTCCGGAGTCTGAAGTCAGAAGC
CACTTCAACACTGAGTACCTGGTGTATACCACGATCACCGGACTTGACTCTACTAGAGCTCTGAAATTCTCCAGAACTCTGAGAATCGCAATCACCTCCT
TCTCAGCGATATGATATCGGAGCTCAGCGTCATTCAGAACACGTCCAGTAAACCGGACTGGATGAATCACACCGTCGTACTCTCGTCTCAAGACCGACGA
GGCAGCCCAAGGGTTCGCGTGAGGGACGATGACGAAAGGTCTTGACCGGTCTGGGTGTCTGAGAAACGGTGTCGAGACAATCTTGCGCTTCAGAATTTCA
AAAGCTACTTTGGCACGAGTCAGGTCCCGTCCAGCTCGAATCTGCTCATCCGTCAATTCGTAGAGTGTAGCAACAATCACCGGCAAGTCCTCAATAAACT
TGCTGTAGTAATTCAGACTCCCCATGAAACTCTGAACTCCTTTAAGGGTCGACGGGAACGGTAACTCTGGGACCCCCTTGGCGATCTTCGGAGAAGCTCT
CAGACCTTCAGCGCTAATCTCATGTGAGAGGTACGGGATCGAAAGTTTCCCAAACTCACCCTTCGGCAGGCTAACAGAGATATTCCAATAACGGAGTCTG
ACTAACAAGGCGTTCAGATCTTCGCAGAGTTGATCCCACGTTGGCGCACCATGAGCAATGTCGTCAATGTAGGAACTTCGACCTAGCACCAGTCCGATTG
AGGATGGAACAGGGATGTTCCTCTGAAAGACAGTCATTCGCTCGATGAGAACTGGTAATTCAGACTTCAAAGCCTGTACTTCATACTTCTGCGGCTCCAA
CTTCAGAGATTCCAAGACGTCACTGTCGACCTCTGCCTCCTCCTCTGGAGAGAGTCTCACGAACCTCCACAAGCAATTATCCAGCATCGCCTGATATACC
AGCGGAGCGTTCTTCAGACCAAATGGCATTCGGACCCACTGAAAGTGCCCGAACGGACAAATGAACGCAGAGATTACTTGGCATGCTCTGTCCTTCGGAC
TGACCAGAAACCACTCGCCATGTCCAGACTCATAAACCACATCGCCGGCTCAAAACCAATCAGAAGATCATCAGTGAGTGGTAACAGGTACCGCGACAGC
TGAATAAAACCATTCACCACACGATAGTCGATGCACATGCGAATGTCCACACCATTCTTCTTCAGAACAATCACAATTGGTGACGCCCATGGTGACACAG
AGTATTCAATGAGTCCAGTTTCCAGAAGTTTCCTCAGAAGCTCGTACACTTTCACCATGAGATGGGGGGCCAAGGACCTTGGAGGTTGGGTGACTGGTTT
AGCTTCGCCTACATCCAAGTCACAGACCACGCCCCTTGCCGGTGCGGGTGCCGCATTGCCGTCTCCGAGGAAAATCTTCCGGTGGTATTTCAGAATGCTC
CGAAGCTTCTCATCGATTTCTGGCGTAGTCCTCTCTGGCACTCCAACGTCAGCTTTCTCAATGTCACACTCTGGAGTCAGTTCGTCGAGCTCTGGCAACA
TAACCAACTGATCACGTAGTTGAGCGAGAAGCTCGGTTCCTTCGCG