Description :
From Genome Similarity Track
Location :
Scaffold_601:14870- 16239
Transcript NameFunction/comments
Phymu_g11085conserved hypothetical protein

Sequence
1369 bases(100 bases per row)
AGCGGCAGTCTTGATGTGGTCCATGCTGACGAAGATGGTGGTTTCAATTGCTTTTTGCTAGTGCTGGTGGTCACGGACGCGGTGGTCGCTGTGAAGTGGA
AGGCAAGTTTGAAAGTGAGCTCACCAGAGGCGCAGCTTTCGGCTCCGTATCCGCCATGAGGCTTGCCCTgcccttgctgctggccggTCCATTGACAGGC
CCGTTACTgcgccgttgctgttggtcCGCTGTGACttgcttcgagcagcagaattTGTACAGCCGGTTGCCCAGGTTTGTCTCGTCCGTGCGCCACGCCA
CGGCTTGAATGGTCTTGTAGGCGGATGCCAGGCTGTACGCGGGTCGCTGCGCAGAGACGGCCAAGCTCGTGGTGTTGTCGAACAAGTCGCAGCGTTCTAC
CTGTGGAATTCTACGGGATGCACTTGAATCTCTCATACTTCCACCGAGAAACCAACCCGGGAAGAGCCAACTCGAGTGCAGAGCAGCGCAGGCACACGTC
CCCCTCCGTTCGCGAAAGCCATGTGGGCCAAGGGGCAGACAGGGGCAACACCATCGTAGTGGAAACCGTGGTTCTTTGACTTTTTTTAGTTTGATTGGAA
GTCGTTTTTCTCTATGGTAATTTGATGCCTGTCGAACGGCGAAGAGGTGGTCGGACACCAATATGCAGACCAAACTGTATAACCCCGAAACGTGGGAGTT
TGCAGGAAGTGAGACCATGGTTTCCAGAGCAGATATCCGCCTGCGGACCGACATCCAGCTCCaaaggtacatgtacccgCCGTTCGCGCTGTCCCGCAAT
TCAGGGTCATTACCTATGCGGCGACAAAAACCTAGAGAAAAGCCTGCATGAAGGTGGCTACACGTCGAACAGATGACGGTCCTTTGAGCGTCGCGACGCA
CTAACGCGTCTATCCAAGTTTCGAGCGCTCCTAATGCCGCGACGTCCCTGTGAAAAATATCGTGGCGGTGTCCTACATGTATCTACATCGCTGCTTACGG
GCATCGCGCTTCAGTCGGTGCTTCGCAGTAATTGCCACTGGAAAGCGCTGCAAATTTTGATCGCCTGGTAAGATACAGCAGCCTTTGCATTCACTTCGTG
TGTTTCTTGACCGATGTGCTCCAGCAAAATTAAGGCGCCGCGGCTGTAATTACGAAACGCGCTTTAACTGCGGCGCCTTTGACTCAAGGCGCGCTGCTCG
ACTACCGTGATTCCTTGATAGCACGACCAATTCCAACCTATAGAGCAGCTGGGATGATCACTTCCAGCCGAAAATGCGAGGGCGAATTGAAGTGGGATGA
AAGCTCTCGAGATACGGCAGCTCTCGAGatacgtacagtacagtacgGCCGAGTGTATCCGTGTGCGGG