Description :
From Genome Similarity Track
Location :
Scaffold_15:148659- 150874
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05177Hypothetical protein
Sappa_CBS223.65SPRG_05178conserved unknown protein

Sequence
2215 bases(100 bases per row)
AGGTTTGCCGTGGCGCCGCTGCATGTAGCATCGCATGGGCCTTGACGACGTCGAGGAGCGCGGTCTCCTTCGACGACGCCAGCGACGATGTGAGCTGGAG
GACGCTCTGAACTCGTTCGCGCGACGCGTGGAGGAACGCTGCGACGCCATCTACTCGATGCGATGGGTCGCTTGCAATCAACATGAGGATGCGGTACCGG
CCGAGTCGCATCGGACGGACGGGATGAGCCCGTCGTCGATCGGCGACGCGTCGACGGCGGAGGACGGCGCCGAGAGACCATGGACAGCGACACGGAGGAA
GGCGTAGGGCGATAGGAGCTGGCCGAGGTCGGCCGACGCCAAGCCGCAGGCCTGGGCGACGAGACCGAACTCCTTCCCAAAGTAGTCTTGGCACAGCACT
TGCAGCTGCGGCACCGAGAGCGGCTGCAAAGCCTCGGGTGTGAGTCGCATGGCGAGACACGGCAGGGGCGTACCTTGTTGGATTGCAGGAGCGACCGCGT
GCAGACGCGGAAGACATGCGAGAGAAGGTCATTAGGCGACGACAGCGGCAGCGCCACCGCCTTGGGCACTAGACACCGTGAAGGTGGAGGAGACGAGAGA
GATGACGTACGGGCCATGGCCTCCGGGTCCAGCGGCTTGTCGACGATCGTACTGTGCGTGAAGTGACGCTTGGCGTGCCGAGGTGGCGCCGCGGAGACGG
GTAGCGGCCGCTTGTTTTGTGTCGTGCGGATCGGTGGCGGCGGTGCGGCCCGCTGCTGGTTGACGCGCTCGAGCTTTTCCCGCGCAATGCGCTGCTTCTA
CGAGGCAAGGATGCGATGCATGGAAGAAGACGATGGACCAGGTACCTTGAGCGCTTCGGCCGCAGCCTTCTCGAGCTCGGCGATCTTTTCCCGACGGGCG
ACCTTGGCTTTTTCTTCGCGGAGTTTCTGGATCAGCAGCCGCCGATCTTCTTGGTTACTCTCGTCGACGCCAGCGCCCAACGGCGACGAGAGGCGCTGCG
GCGTTGCGCTCGCCGACGTTGTCGTGGAGATGGTCAGATTGGCCGCCAAGATCGGACTCGAGCTGGGTACTGGGCTAGCGACGGGCGCAGACATTTCGCT
TCGAGCCACCGCTGACGTCTGAACCGCTGGCAATGCGGTGGGACTCGCAATGGGAGCAAGCAATGATGGGCTCTGCACTGCGACCGAAGGTGCAGATTGG
CTCGCCAATTGCGGACTTGGGCTACGCACTGGTGAGCTCGCAATTGCTTGCAGCGACGTCTCGGTTGACAGCGCCGCTTGCTCGATGGGCTGCTCTGCGA
CGGGCGATGCGTCGGGGCTCGGGCATGGCGGCGCTGCAGCCTCGAGCGCCCGCTTCTTCAACGCGCGGGAGTGCCGGACCTTCCACAGTACGAGCTCTTG
CTCGCACTCGGCGAGTTCTCGCTCAAGGTCCTCGAGGCTCGCGTCGTCGTCGGCGTCGATCCCGTGGAACATCGTCGTCCAAGAATCGCCGGATGCGCCG
CGAGACCCTCTCGTATTTAATATCAATCGTATGCGTTTTGCAGAGGTACAGGGTAAACGCGTTAAATTGCCATTAGTGGGTAAACTGATCGACGTACGCC
GCGAGCGCCTTCTCTTCGGCCGACTCGCCGAGCGCGGGGCCGTCGCCGCCATAGTCTACACGCAGCATACAGCGTTGTTTCCAGTGGAACAAAAATACAC
TGCATACCGGATGGCAGCTCGGCCACGTCGATCGACTTGAGCAGCTCTTCCTTGACCATTTTGCCCTTGCAGATGCGAATCTAATGCAGACGATCGCCAT
CCATCCAGTATTGTTGTGCATGGCAACCTTCTCCTTCGTAACAGGGTCGACGAGCGGGCTAATGCCCTTCCAGATGACGTTGAACCAGGTCGGGACGTTG
ACGATGAAGATCTGCGCGCTGCGCTCGGGGTAGTGCGCCGACACGAAGGCCATCGCCCGGCGCACAAACTCCATGACCTCGCCCGTGAGGTCGTAGAACC
CAACGCCTTCGGCGTCGAGCACCGAGATGGTCCGGCCCGTGTCGGACGGCTCGAGAACGAGCCAGAGGTACTCGGTGATGTACATGTAGTGGCGGAGGAG
CTGGTCCAAGCTCAAGCCGGCGCTCTTGAGGCGCTTGAGATCAATCTTGCCGAGCTTTTCATAGTAGACGCAGTTGCCCTACGCATGTCTAAGTATCAAG
TTGATACAAAGGCGC