Description :
From Genome Similarity Track
Location :
Scaffold_25:148655- 162128
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06765dynein heavy chain

Sequence
13473 bases(100 bases per row)
TAATTGTCGTCTTGAAAGAGAATTGCTACACCACGAAGGACCCACTTTTCTTGCCCGCAGTCGGTTGGCAGCGTGGCGAGGAGGACATAGGTCGGACCGC
GGAAGCGAGTGAGGTACACGGGGCACTCGTAAATTTCAGGATCGTGGCGCAAGTAGCCCACGGATGTGGGCTCCCACAGCGGCTTGGTCTCGACAGCCTT
GACATATACGACGGGCATCATCCACAATAGCTCCTTTGGGTTGCTGTCCATGACGATGCCACCACACTCGGTCGCCGGCGACGTTCCGACCTTGTACTTG
GTCGGAATTTCATCCACCGTGCTCCAGCGCGCGCCTTCGATGAAGAGGCCGTGGACAAAGACGCCGTCGTCGGGGTAGTACGTCATAGCATCAGCGTTGA
TGACCGTCGTCATGTGCGTCTCGACCGTCATCTTGTTGAGCGGCATCCTATTCAGCTCAGTGTTACAACCATCGTGTATTCATCACACGCCGTACATCTT
GCGGCGTGACGTGACTTGGAGACACGCGGTCGTGTACGCCGTGGGGTTGAAGAGCCCTGGGAGCCAGAGCGAGAAGGGCGTAATAAAGTCCGAGGCCCAT
TTCTGCAGCTGTGCATGGCGCTTGACCATGTCCACGAACCAACCAGAGAGCGATTTCTTGCTCGGCCACGCCTTTCGTTCCCACTTGCACTGAGAAAACG
GGTTCCGACCAGGCACTTCGTTCAGCCCAATCGCAGTCGCGAGGTCTTCCATGGACTGCGACATGTTGAGCTGCCCGTTCAGACCCTTCTTGAGGTCGGC
CAGCGACTTGCGAATCTCGTCCAAAAGTACGTTCATGCGGTCGCACTCTTGGAGCGCAACGACGACAAACGGACCTATTCATCGAGCGTCTATAGAAACG
CAAGAAATGTGCGTCGTTGTACCGTGGTCCTGGGTCAATCCGGGCGCTGCGACTTCTTGCAAGTCGAGCATCATGAAAAATTCGGGCGTCCGCGCCTCGA
AATCGTCAATCGTTGCCTTGAGCATCGCCGTCTTGTCCGAGCCGCCACCACCACCGCTGCCACCGCCGCCGCCGATACTGACAATCGTGTAGCAGAGCGT
CTCGCACGTCGTCGTGAGATACCTACGATATGGACCGCCATAAATACATAAAATTGCGATCGACAACGTACCCGATCTCGGCGTTCGGGTGCAAGCCAAA
GAGCGGAGGGGACTCGGGCACCATGTTCTTCTCAATGTACGTCGCGTAATCCGAGAAGGAAAACTCGGCCGGATTGGGCGACTTGAAGCCGGGTCCAAGC
TCCATACCGTTGAGCAAACCTGGGTTGATGAGCACCGTCAGGTATGTGTTGTTGGTGCGTCGATCCCAGCTGTCGGTGATGTGCCCGCCGTACATGATTT
CGCCAAAGATGTATCGAATGTCGTCCCACGGCACAGTCGCGTTGTTGTCCAAGTAACTCTGCAGCACATTGCCGCATATCGTGAGATCGCCGGTGTTGAA
GCTATACGCGCGGCTCCAACCTTGCTGCCCAAAGCGCCGACGCCCGAGCACGATGGCATGGAACCAGCATAGCGAGAAGAGGCAAGCTTTGAACTCGGTG
GGCTTCGTGCACGCATCGACCTTGTCTTCCCCAAACGTTGCCCACGCACGGCGGAGATTCGACTGAATGTCGGAGGGCGCCTCGTTGGCGACCTTGATGC
AACTCTGCATGAGCGACTCGGGCACATTGAGCTCGAGCGGTAGCAGAATCGGCGGCGGCTCGGCCGAAATGAAGCACCGGAAGAGTTCGTGCGGTCCTTC
GCCAACGATCTCTTCGAGCTGGCGCTCGAGCATCGGCAGCCACGACTGCATGAGATGCACGTTCTGGAGAATGATCCAGCCGCCCTTGGTTGCGAGCTTC
TTGAGGCAGTCGCCAGCATGCTGTTCCTGGCCTACAAGTCGCTAAGATATCGCGTCGGATGCTAGGCTTGCGTACCTTGGCCCATGGAAATGTTGATAAA
GTTGTCGTTTTCGATGCTGACGCCCTTGGTGCGCCCAAGGTCCTCGACCCACGGCGTCGGGTCCACGCCGGGAAAGAGCACAAAGAAGATCGGGATCGCT
GGGTTCGTCTCTTCAAACGTCTGGAGCATATCGAACGGCGGCTGCGTCACGTACTGTTCACCTACAATGTGTTTTAGGTATCAAAGTATCAAAACACATC
ATCGAGAAATACCGAGAGCGTCCAGAATGAAGCGCCGGAGGGCGTTCGTGACACGATCGGGGCGGAGCGCGCGAAGCAGAATGATCTTTTGAAACGGCGT
GAGCTTGGTAAAGTCGCCCGGGAGCTTGCACTGCTCGGCGTCTTCGGCTGCGAACCACTTGCGCCATTCGTCCGGGTCGTTCTGCATGACATCGGCCACG
GTCGCAAACACCTTGAGCGTCTCGAGCGCCTTGAGCTTGGCAAAACAGGACGGCGGCAACCACTCGGCGAGAACGCCCATGTTGCCCGGCTCGGCCACAG
ACTTTGCGAGGAGGAAGGCGTCGACCTCGGCGTCGACGAGGCCGCCGTCGCGCAGCAAGATCTTGAGACAGAGCATGGTGGCGACCGTGAGCTTGTCGCG
CTCAAAGAGGCCGCGCCGAATGTAGTTGAAGACACACATGGTGATGCTGGAGATCAAGCCTACGCGATCGAGCTCCTACCACGACCCATGCAAATCAAAA
GAGACGCACCTGTGCAGCGCGCAGCGATATCTTCGTCGGAAAAGTCAATCGTGGTTTCTTCGGCGGGCGGCGCATCGGGCGGAGGCGGTGCCTCGCCATC
GACTGCGGCGTCGGCTGGGGGCTCGTCGGCTACGGGAGACGCCATCGGGAGGTTGTACACGCCTTGGAGAAAGACTTGCTGGAACGCAGCGAGCGAGTAG
ATGTAGTACGAGTGCACTTTGCTGAGGTCGATCATAAGGAAGAAGAGGAGCGACCCGCGTGCGGCGATCGACCGGTACTTTTCGCTCGTTATGTTGACGC
TCTCTTGGGTCTTCTTGGCCGCCTCCATGTTGTTTTGCGTCATCTGCGCCTTGTACTTGGTGTCGGACAAGATGGCGATGAGCGGCTGGTTGTTGGTGAT
ATCGTCGTCGGCTTCCGCGAGGTACTGCAGAATAATGTCCTCGAGCTTCTTGAGCTCGATCTTGCCTTGGTTTGCTGCTGAATGAGCTTCTCGCGCTTGA
TCGCGAGATCCGAGCGCTCTTTCGAGACAACGAGGTTGAGCAGCTGGTCTTCGAGGCCCAGCGCAGTGACGGTAAAGTTCACCATGGTACACTCGGCCTG
GATCTCTGGCGGGTAGTGCGGGTTCCCGAGCTTCGTGTGGAGGTACAAGCGAAACTCGTCGCAGTAAGGCACGGACGCATCTCCGACCGTGATCTCAATG
CGGTTGCCGCGCTTGGACGTCGAGCGCTGGATGACAGGCGCCAGGATCGCGTCGATTTTTCGCCGAGGTTTTCGATCAGGAACGCCGTCTTGGTGCCGAG
CGCCGTCTTGAGCTTCTCGATCCAAAACTTTTGGCCAATGCGCACGATCTGGAGGTTGAACGGTGCTTCCTTCTCGCGGATCCACGCAATCGCTTGCAGC
TGCGGGTCGATGATGAGCGGCCGACGTCCTACAACGTCCAATATTGAGAATTTCCCGAAAATTGAGAATTTCCCGGACAGATGGACGAGACACGTACCCA
TGGCGACCGTGTTGACGACAATCGCCCCGTTTTCCGTCGAGACGCGATCGGCAGGAAGACGCTGTGTGTTCCACTCGGCGATCTCAGCGTCGTTGGTGAG
AATGTACACAGGGTTGCTCTCTTCGCTCATCGCGATCGAGTTGCCATTCGCCGCCTTGCGCAGGTATGGCACCCAGTGCTTATTGATGAGCTCGTCCCGG
AACGGCTTGGTGAACGGACCAATGTACGAGATGAACGCAGACGCCAAGAGACAGTCGCCCACGAGCAGGTCCTTCTCTTTCTGCAGCTGGAGGACGTTGA
TGCCCCTAGTGATGCACGCGCGTCACCGACTGTCGAAACGCGGTTGTCGTGATCGTACCAGCGCACGTTTTCCGAGCTGAGGTCCTTGGTGAGCGTACCG
GCAAGCTTCATCTTGCGGTTGCCTTGCTCGACCGAGTTGATAGCGTCTTCCTTCTCTTTTTCGGCTGCGGCGGCTTCTTCAAGCAGCTTGCTGAGCTTGG
CGTTGAGATCTACGCATCTTGTTGTAGGCGTGGTCATGGACGTATGGCGCACCTGCAACGAGCGACGTGACTTCGCCGAGACGCTTGTTGGCGGCCTCGA
GCTCCAAGTTGGCCGCCGCCAGCGCCATACTATGATGGACGATGAGACGGTGGAGACGGGGAGGAGGCGCGACGCACCGCTTGGGCTCGACCGTGACGAG
GATGTCGTAGTACATCACGATGTTGACGACCCAACTGCAGAGACCGGCGGCGGCTTTGTTTTTCGTCGCAATAATGTCGGGCTTGAAGTACTCTTTCTCG
AGGAACTCGCGCACTTCCTTCCAGTTTTGCGTTGGAATTTGGTTGGCATCCACGAGGTCCTTGAACTTGAGGAGGTACTCGATGTACTCTGGGATGTTGC
CGAGCACTTGCTTCTTGCACGCGTCCCACTTGAAGTCCTTGACCTTGCCTTGCTTGGTCACGACGACGTTGGGATGTACGCCGGCCAGAAGCACCATCGT
CGCTCCGAAGACGTCGTCGACACCCACCGGCGGCTTGGACATGGTCTTACACTCGCCGAGATCCTTCTTGTTGAGCGAGTCGAGGGCTTCCATGGCTTGC
TGCACCGCCGGCTCGGCCTTGGCCAAATCTATCACCCAACATGTGTTTCAACAAAACTTGGTTCGCTCTACCGTACCTTCCATGGTCGAACGCTGCTTCT
CGGTGACTTCGGCTTGGATGATGGCGCACTTGGCAGCTTCTTCCTCCGCCTTCTTGGACTCAACCTCGACTTTGGCTTTTTCCTTGTTGACCGTCTCAGC
GATGCCGGACGCAACGGCCTTCTTGTCTTCGGCTTGCTCGAGCTTCCCCTTCAGCTCCACTTCAAGGCGCGCGACCGTCTCGCCCGTTTCCTTGAGCTTT
TGCAGCCCTTTCTCGAGACGCTCGATCGCACCGGCGTACTCCTTGACCTTCTTTTTCAAAATGTTCTTGTACAGCTGGAGGAGCTCGAGGTACGATTTGG
GCGTCGTGTACACATACCTACAAGGACCATTGTGTTGGCTGGCGCTCATTCCATGGAGAGCAGATGTACCGTCGTTCGACTTGAAAGAAACGCTCGGCGC
ATTGATTCACCGAGACAAACGAAAACGGCATAAAGTTTTCAATGCCAGCGCGCGACTCGTCCGAGCCAAGGAGGTCGCTAATGTCCTTGAGCTTTTCCTT
CCCGACACTCAGTAGCGCTTCTTTGGGCCACGGCTGAAACCATCAATGACGGTGCAGTTGACGAGCGCCGGAAACTTGCGCGCGCGGCTGCGAAAGTCGT
CGCCGACAGGGGAAAAGCAGAGGCAGAGATGGAGGCGCTTGCGGATCTCGCTTTGAAAAAACTTGATGACTTCCTTGCGCTCCTTCGTGCCGGCCATGAC
GCACACCATTTGGACGATATTGTCCATATCTTCGGTTGCAAAGAGGTCCGGAATGTCGCCGGACGCGAGGAGATCGTTCAAGTAGATGAGAAACTTCTCG
TTCGTGATCTGCGAGTCGGTGAGAAGGAAGACGACGCCGCCTTTTTCTTCGCTGCGACTGCACTGGTCGGTGATGACCATGTACATCTTGCGCAGATCTT
CTTTGAACTCGTTCTCGCCATACTTGCTCGAGATCGAAATCTGCTTGACCGTGTACTCGCAAATGTGCGACGCCAACCGCGCCAAGGACCGCTTCCCCGA
GCCCCCGACACCGACCAAGAGCGCGTGCCTACATCATCGCTTGAGCGAACGATCGACCGCGCGGACGTGTGTACCCGGATTCGTTGCGCAAAATACGCAC
AATGCGCGCGACATGCTTGATCGCGTCATCAAACAAGTCGAGGTACATGGCCGTGTTGTTTTCGTTGTTGTTGTAGTCGCGCAGTTGGATCTCGAGGTTC
TTCTTGAGGTCGTCGAGGTTGGTGCCGTTCACTTGGTCGTACTCGGGGTCCCCGTCCTTTGTAAAGTGGCAGAAAATCAGCGGCCACGAGTTCTCGGCGG
CGTAGTAGCGCGACGTGTTGCACGTCGGGAAGCTGCGCTTGACTTGGAGCTGCACGAGCTGGTTGTACTTTTCAATGTCGGCCTTGCACACGAGGCGGTC
GCCGTACACGCGCTCGCTCTCGTGGAGCCAGAGCAACACGAACTTCTCGCTCGTGTTGAACCGGTCCTTCTTGCTCGCAATGAGGCCCTGGAAGACATTC
GAGAGGTGCCGGACGTTGAACTCGTAGTGAAAGTTGGCTGCTGTCTTGCGGAAGGTCTGGACCACGCTCGTGTGCAGCGTGAGCGCCGCCTTGATGAGCG
CATTCCAGAACGACGACGTGTTGAGCTCGCCGCTGAACGTCCCTAGGTGACCGCCAAGGAACGTTTCGTAGATGGTCACGAGCGACGGCGCCTCGGGCAT
GCCCATCGCGAACGTCGTAAAGTGCCGCTGGAGACGCGGGTCCACGAGGAACGACCCGGCCGTCGGGTTCATACCAGCCACGATTTGCGTGTTGAGAATG
TTTTGCACTTGGAGCTTGGCGCGGTCAAACCTAGAGCATGCCATCGTACACACGTGATACACTGATACCAACCGTACCAATGGTGGTACTCCATCTTTTG
CCGCAAGAGCGAGATGGCCGACTGCGTGTTGTACGGGTCGACTTCGGGCAAATTGAGATCGTCCATAAAGTAAATGAGCCGAAATTTCCCCGGCGGGCCA
AAGTTGGAGCCCGTCTTCTTCTCGAGGTGGCTGAACATGGCGGCCTGGAGGATCGCCGACGTCGTGTAAAAGTTAAAGTTGAGTGTCGTGAACCGGAACC
CGTAGTTGGCGTCTTCGCGCGAGAGCTTCTTGAGCACGCCGTTGACGTTCTGGGTCTTGCCTGTGCCCGCGGGCCCGCACACCATGAGCGGAATGCTCTT
GCAAATGAGGTTCTCGAGCCAGAACGCGATCGACGACGTCTCGGTCGTCGGCACCGTAATCTGGTTGATCGGGTCCGGCGACTTGTACGTGGCCGTGTAA
AAGTACGGCGACTTGCTCCACGCGTTGAACTTGGCGGTCTCGGGGTCGAGCCAGAAATCAAACACGGTGTTGCTCGCACTCGCCACGATCTTGACGTCCT
TCCACGTGTTCTTCCACCAGTTGCTAAACTCGAGCGCATAGTCGGTGCCGTCGTCCGAGACGGTGAGAATCGACCCAAACGCCCAGACGCAGCAAAAGCA
AAAGTTGTGCTGCATGACGCCATAATCCGCAAGGACCGCTGGCGTCAAGAGGCAGTCGAGCATGTTGAGGAGGTTGCCGACGAGCGTCACCTCTTCGACC
GGAATGATGGGCACGAGGCGCTTCTTGAAAAACTTTAAGTCGGTTCCATGTACGTGTCAAAGAGGCCTTGGAACTGGCCGCGCACCTCGGGCGAGAAGAG
GAGTCCTTGGTCCTTCGCCTTCTTCGTCGGGTCGGGCGTGCTGTGCCGGAGGAGCCACGAGTCGATGAGACACCGCCATTGGTAGCCCTCCGTCGCGCTA
ATATAGAGAATACCGGCGCGGGAGACGGTCGCAGGCGTCGCGTACACCAAGTCGCGGATCTCAAAGATCATGCGCATGTGCGACTTGAGCGGGACGCGCT
CGTTGGAGGCCAGCGTGAGCATGCGGTTGTCGTCCATGACCGAGTTCATCGACTCGATCCAGTTGGCGTCGAGATCGCCATCGAGCAAAATCCACTTGGG
CGACGTGTCGTCCTCGCCGTTCTCTTTTGTGCGCGAGCCAAGGTCCCGCATGATCTTACTCAACAAGCCGTCCTTCCACTCGCGCGTCTTGAGCACAATG
TAGCCGTAGAGTTCGTTCGTCGAGACCGACTTGGGGTTGAGGTCCTGGATCTCCATCGAGACGCCCATAATCTCGCGGGCTTTTCGAAGCGTTTTCCACG
TCTCTGTCTTGCCACATGCTGGCGGGCCCATGACGAAGACGCAGTGGCGGATTGCAAGGAGCTCCGAGAGCTGGACGACCTTGAGCATGAATTCTTCGCG
CGGACTAATAGGACACCCCATGGAGACCATTTCAGAATCGCATCAAAAGGTGTACCTGTTGTTGATGGCCTCGCACGCGCCTTGCACCATCGACTCGAGC
TCCGGGTCGCGCTTCCGGGGTGGGTCGTTCCGGACGTCAATGTTGGGGTCGTTGCGAGGAAACAAGTCGCCGAGCAAGCCAAAGAAGATGACGTTGTCTT
CCACGACGATCTTGGGAATGTTAAAGTCCCGAAGCGCGCGCATGAGCAAATCCGGTTCGGGAATGTCGGGCTCGGCGCGCTTGAACGACCCAGCGACACA
GAGTACCGACTTGACCGCGCGGAGACCTATCGACACCATCACGAACAATTCGTATAGCAGCCAGGGACGCACCCCAATCGTAATGTAACTGCTTGGAGAG
GAGTTGTCCAAGGAGCGAGTACAAGCCATAAAATTTGGACGCGAGGATTTTGGCTTGCGTGAAGCCTTCGGCCATGAGCATGTTTTCGCAGATCAAGACC
AAGTCGGGCACCATGACCGTCATGGGTCGGAAAAGTGCTTTCAGACCTTCGGGCAGCTCCGATCGACCGAGGTACCCAGGGTTCATCGTGATGAAGGCAC
CGACCGTCGGGTCCAGCATGACGGGTTCGTTCTCCAAGATGAAGCGCTCGTCGTCCGCCTTGCAAGCGTCGCAGACGGCCTTGAATTGGACCGAACACAC
GCTGAGCACCTCGGGCACGAGTCGGTTGAACTCATCAAAGCAGCCCCATGACCCGGACGAGGCCAAACCCTTAAAGATGTTGCCGAGACTCTTGTAGTCC
ATTTCAGGCGAGCAGTTGAAGACGTAGCAGGCCTTGCCGAGCGCGTTGGCGAGATCTTTTGTTGTCTCGGTCTTGCCCGTTCCGGCCGGCCCCGCGGGCG
CGCAACCCATCTTGAGGTTGAGCGCTTGCGTCGCCGTGACGTAAATACGATCCGTGAGCGGCGTAATCACAAGCCTATAAACCACAAAAAAGGATCAACA
AAACTCGGCAAAATCAACACTTGGACGCACCGAGGGCCGTTCCCGAGGTACTCGTAGTCGTACGGGATGCCGGCGTCGCAAATGAGCACTTGGGCGCGCG
CGTTGTTTGGGCCGCGAAAGTTTTGGTCCCGATTGAGAAAGCTGCCTTGGCACGGCGAAAAGTAGTGCTTGAGCTGCGACTGCCACATGAAGCTCGTCGC
GTCGTCGACGCCAGCGCGGATCATATTGGCAACGATATCGCGACCATGCGCGTCCATGGTGATCAGACACATGACGCGTTGGCGCTCGGCGTTCGAGATC
TTGCTCTGCGTGAGCTTGATCAAATCTTCGAGCTGCCCTTCCTGCTTCTTGTTGTAGCGCGTGAGCGCTTCACGGTCGCCGCCGCCCATGGCCCGGAACG
CGGCCTCGACTTCCTTGACGTAGTGGATGCCCGCCGAAAGCAAGATGATTTGGGCCGCGTCAAGAGGCTTCCCCGTTGGGTCCTTGTAGTTGATCCACTC
GACGCGTGGCTCGGTTGTGTAGAGCACGAGCGAGCGCTCAATGTGCTTGAAGAGCGTGTACTTCATGGCCTTCAAGAGCGCCTCGAGGTAGATCTCGGCC
TCGCCATCCAAAAGCACAGGCTCGGCAAAGTCGACGATCTCGTGGCCGACGCCCGAGACGAACGCGACAGCGGTCGGACGGCCCGTTGGCGCGGGTACCA
AGTTCATGGTCTTGCACGCGAGGTAGATCTTGGACGCGTGCGGCATGATCTTGGCGGGGTTGGACCCGTTGGACAGAATGTCGAGGAGATCCTACGCACA
ATCGTTGACACTCAAAACTCAAAGTTATGGGGACGTACGGCCTCGGACATGAAGTAGAAGCGCGGGAATTGGCGCCGACGGCCGTCGAGGAACTCCTTGA
GCCGGTGCTTGCAGAGCTCCAGCTTCTCGACGATGGACTCGAGAAGCTTAAAAAGACCAGGCACCGTGCACGCCACTTTGACGTTCTTGGTCGCCCAGGC
TTCGCGCAAAATACGGCGAACCTCGACATCAATGTCTTCAAAGTCGGCTGTGAGCGCCGGGAGCTGGTTCTTGACTTCTTCGCTCTGGATGAAGAGCGGC
TCGAGGTAGCTCCACGAGCGCTGGATGTCGCCGAGGATGACAACGACTTCGTTCACGGATGCGAGGCCTTGGTGCATATCGGTGACGCGCGTCTCAAAGT
CACCTTGATACGGCGATGACGTCATGGCTTGGCAGTCGATCTGGTTGGTTTCGAGCAACTCAAAGTTGTCCTCGGAGATCTTGAGCAGCGGCACTTGCTT
CTCGACCGGGTCCGACGGGTTGTAAGGCGACATCTCCCACTCCACGAGCGCCCACGTTTCTTCGAGCTCGACGAGCTTGAGCTCAAGCTCCTGCTCTTTC
TCGGCTTCGTACGCAATCTCGCCAATCTCACTTGCATACTCATGCAGGCGCTTGCTCAAGAGGAACCCAAGCTTTTGGTCGGGGTCGGCGTCCGGTGGCG
TGAACTCGCCCGTGTGCTCCATGATTTTCTGCCAGTGCCGCGGTCGCATGTAGCTCGAGGCGAGGCACCGGAGGAGAGGATGCGTTTTGTCAAAGCCTTG
CGTTTCTTTCAAGATGACTTTGTACGCGTCGCACCACTGAATGTCGCGCGGGATCTTCTTGAGCTCCTTCAAAACGGCTTGCGTCTCCATCGCGAGCATG
TTGCAGTCGACGTCCTTCCATAGAATCTCATGCGTCGACGCGAAGAACGCTTTCGTGCGTTTGACGATGGCCCACACGGCCTTGGCGCCGTCAAAGTCGG
AGCGGATCGCGGCCATCGTCGCGTGGGTTTCGTTCATGCGCTGGGGGAAACCAAAGACGTGGCTCAAGTCGCTCTTCTCGGCGCAGCGCTTCTTCTCGTT
CTCCCACTCGACGAGCTGCATCTCGATCTTCTCGAGCGCTTTCCCCGGCTCGAGTTTCGAGTCCCAAAAGTCGAGCGTCTTGATGGTGGCCTGCCACTTT
TTGACTTTGATTTCGTACTCGGCGATCGTCGCCTCGGTCTTCTCGGAGAAGATCCGCGTCGGCTCCGTGACGCGCGTCTCAGTTTCGGGTACTTGCACTT
GAATGTCGTGGTAGAGTTTAATGAGGTTGTCGACGTCCGCGGCTTCCTTGTCGACGTGCCCGCCAATTTTCTTCATGTACTGAAAGAGGTGCGCAGTCTG
ATCCTGAAGCAGCTGGTTGGCCGCCCGGTCCGTCTCGAGCTTCCGGACAAGGTCTTTGATCTTCTTGAGCGCCTCGAGACCGTCCGCATCGTTGCTCGGA
ATGTCCGCCTACGACGTTACTTTTGTCTACATGCACGCTATCCATCTGGGTCGTACCTTGAGCTCTTTGAGCACGCGCTTGTAGTCGCCGGCGCGCTTGG
TCGTGTCCGTGTAGAGTTTGCGGATGAGGTCGGACGAGTTGAAATCATCTTCTTTCGCGACGCTCGGAACGCAGCGGATCGCCATCTCGTCCGAGGGCGG
CTGAAAGCAGCAGGCGAACGGCGACCCGCGAATCGGACCCGCGACCCCGTCAAACGTCCCTTCAAACGTGACGTGGACCATGTACTTGCCGGCCGCCGGC
GGGATGAACGTGACAATGTAGCGCCCGTCGCCTTTGTCGTGGATCGTCGTAATCTCAATCGTGCTCTCGACATCCTCCGCACCGTCGGCGGTGCGTGGCA
CGAGCGTGACGTGGTAGACGTCGCCGCCGCAGTCGCGAGCAACCCCGTCCTTGTCGATCGACTGGAGCACGAACGACGTCGGCTCGTTCGCCATGATCAA
ACTGCTCAGCGACAGCATGACGCATGGACCATACGCCATGCTCTTGGGCGCACTCGTGACGCTGTGAAACTAGTTGATACCGTCAGCACCACGAAATCTT
TCAAACTATCAAGTGGGTACCTTGAACGACGTCGCGATGTTGGTGAACGAGTCGCCGGGCAGAGACACGCGGACTTCGGTTGCGAGCGGCCCGTACTTGT
CAAAGTTGGGCGTCGTCACTTGCACGACGGTCGGTCCGAGCACTTGTCCCTGGACGTCCAAAAACCCTTTTGCAACCGCAAACCGAACCGTGGCGCTCGA
ACCGGTAAAGTTGTAGCCCAGAACTTTGACGCGCGTGTTGCCCGTGATGGGGCCGGACGCGGGCGCGATCGACGCGACCGAGTACGGCGGCCCAACGATT
TCGTTGACTTGGAGGACGTGGACGTCGCCGAACCAGCGGTTGGCCCAACCACCAAACAGTACCAGCTTGTACGCGACCGGGTCGTAGATCATGGCCGTGT
CGGCGCGCGGCAGCGGTGCATCGCCCTTGAGCGACGGCTCGCGCCATTGCATCGTACCCGTGTCGAGGACGCTGACGTTGTTGAGGTACGCGCCTTGCGA
GTTGCCCGACTCGGCGAGGTCGCCGGACGTACCGCCAAACATGAAGATCTTCCAGTGCGGCACGGCCTGAACGCCAACGCACGCGTGGTTCCAAGTCGGC
ACGTGGAGCTTCGAGTCGGGCGCGCTCCACGTATTGGTTTGCAGATCGAGCACGAAGAGGTCGTTGAACTGCTTGACCGAGTTCCAGCCGCCAACGACAA
AGAGGTTGTTGTCAATGAGACACGTCTGGTGCGACGAGCGCGGTTCGGGCTTCTCGCCCTCCGTGAGGATCTCTTCCCACTTCATGCTGCGCAGGTCGAG
CGCGTGGAGGTCGTTAAAGTCCGTGCGCCCGTACCCGTTGCCGCCGTAGCCGCCAAAGATGTACATCTTGTGCTCGACGAGCGTGGCGCTGTGGGACCCG
CGGCACTGCGGCAGGCCCTCCCAAAAGTTCTGCGCGTGCTGTTGCTCCCAGAGTTTGGTCTCGCAGTCGAAGATCCAGCAGTCGTTCATGCGCTTCTCGG
CCGCAAATCCGCCGAATACCACGAGCCGGCGCTCGTTGTACATGATGGCCGTGTGCCGCCAGCGCGGTGGCGGCGCGTCCTCGGGTGCGCTTGACGCGGC
ATGGACGCGCGACCACGCAAAGCCGTTGGCCATATCGAGGCGAAAGAGGTCGTTGCTTGGGCCCGGCGGAATCTTGTGGTCGCAACCTACGCACGTGCGT
GAGCACCTGGCCACGCAAGTTGACCGTCGTACCGCCGAAAAGGTACAGCGCCGACTCGGAGCCGCGGAGCGTCAGCGAGTGGCCGGACCGCTTGTTCGGG
ACTTCGCCTGTGCACTTGGGGTTGGCCCACACCATCTCGGGCTCGGCGCCATAGCCGATGGGCTACACGGAAG