Description :
From Genome Similarity Track
Location :
contig_69:14865- 17189
Transcript NameFunction/comments
g12161.t1hypothetical protein
g12162.t1hypothetical protein

Sequence
2324 bases(100 bases per row)
TGTAACCGGGTACACCGACGTGTACCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGTACGTGGTACCGGTTGGCGGTGAGCCAA
CCATTGGGCACTTGTTTAGCTTTTACTATAGTTGACTTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAATATATATTCAGTCTTTAAACCTACCGT
CTAAGTCGTAGTCGGTTCCCTTAGACCGGGAACCGTGAACTTGTTGTTCACCGAGAGCTTACGCTTTCTAGCACTTCCTCTGTGCAAGCTGCTGTGTGCC
CCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGAACTACCTGAATCCTCTGTGATCTCAAAGCCTGAGCCACTATGGAAC
GAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCCAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGTCCTTGAC
GGCAGCCGAGCAAGTCGAACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGAGAAACCTGGAGGCCTCTGTGGCCGAGCCGAAGCCTGT
CCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGAAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCCATGAGGGCG
GGTCTCATCTCGGATCAGGGACTTCGCATTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGGCGTACACGCTGGAGACGACGTCTCCTG
AATGCTTGGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGGGTTTCGCCAGCGCTCACGCTTCCTCGCCTGTAA
GCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGACGTCAAGACGACGGTC
TTCATGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGCGCATGCATCCACTATGAAGGAGGCGGTTAAGATCGCCCTCCAGGAGGAGT
ACAGCCATAAACAGGCTGGCACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCTAGAGCCTATGGACTTGAGCTCTGTTGAACTTGGCTCGGT
CGGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGGCCTAACGGT
CGCTGGCGCAAGCCGCGGCCAGGTAGCCGAGGGAACGCCGGCCACAAGTAATGGCGGGTTCCCCAGAGGGGGGAGAGTTGAGTCTCCGTGACGGGTGTGC
GGGTAGTGCACACCATGGAGGCTTAGCCTACGAGAGACATTATGTCTCGAATCGGTGATGGCAACGCTGGGTTGCCGTTAGTACACGTGAGTGTACGGGG
ATGTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGCCGAATGCTTTCGTACACCGCCGGAGCGATTGCCAACTCTCTGTGAGAGAGCATCGGCAATGG
TCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTAGGGCGTCCGCTTGGGTGCGCCGTGCCATGG
ACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCGAGTCTAGCCGGCACCCAGCCTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCA
GAACACACGGTATCCGAAAGGATTACCTGGACGCAATGGCGTCCGCCGACTTAAGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAAGTGTTGAGATACCG
TCCACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAAAGTCCAGCGAGAGGAGCTGCAACGCCAGCAGCACCCACCGCTCCTGATCG
TGACGCCATACAGGTCTCGACTGTATCGGCGCCAGGGGATGTAAGTCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCGTGGCCAGG
GCTGAGGTTTCCGAGAGCACCTCCTGTGTGGGTAACAATGTGCCACGGAGTCGATGAGACTCCCGACTCTGCCCTTGAGTCACCACCGGCCGTGGGTAAC
GAAGAACCACGCCGGGGTAGGCAATGACGACGTCGTCGCCGCCGTAAACCGAGTCTGTTGAAACAGACTGGAGTCGCCACGAGCGACTCGGAGTAATCAA
CGCTCCTCAGGCACGGCCGGCTGA