Description :
From Genome Similarity Track
Location :
Scaffold_505:14864- 17866
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_505-abinit-gene-0.25Phosphatidyl inositol kinase (PIK-A)

Sequence
3002 bases(100 bases per row)
TTATTTCAGCTTTGTCGCCACCTTGTGAATAATGTCGACAATGAGCGGGAAGAACGCCGAGACACTGTCGTTGATGAGACCCAGAAAGAACTGCTCCGCT
TGCTCGTCAGTCAAATCCAGTCGGAACTTCTCTTCTACCTTTTGCAAAGTCGTCGCGGGATCATTCGACAGCTCTTCGATCCCAGCGTCCGCCATCAGAC
TCAGCAAGTTCAAGATCAGGTCCGCAGACTTGCGGAGCCAGTTGTATGCCTGACAGCAGTACCTCGTGAACTTCATGTAATGTTCGCTCGCAGGACCACC
CATTCCTTCCACCATCTCCTTTGTCAGTTTGAACGGTGCCGGGTACGGCTTTGGATCGGCACCAAAGATGTAGCCAAAGTCGATATGGAACATGTGGCCT
TGTGTCTTCATCATCAAGTTGTCAAGATGCCGATCGCCAATGCCGAGAAGATACGTGAGAACGCAGTATCCTGCCACCGACTTGACGTACGTATTGAGGG
CTTCTGGAACGACTCCGAACTCGGCATTGGGGTCTGGATTGTGCTTCCTCAAGAAGTGCATAATCTGGTGGGGTGACTCGAACTTGGAGATCACGTACGA
CATCGGGTACGAGTCTTGGACAAACTCCATCAGGCCGTCGCTCGTTCCCGTTGCCAAGATACGGTATGGTGTCAGCTTCAGATCCAAGTTCACCTTCTTC
AGCAACCGGTCCATCAGCGTGAACATCTGCATGATCAGCTGGTCTTGCCGCAAATCGTCGCCATTCTTCACCATCAACTGGTACATCGGCCCCTTCTCGC
GGTGCAATAAATTGATCATCCGCGTCGATATCGATTCACGCAGAATGCTCGAGTCACTCGCACCAAATATCATTGACTGCGACAGATTCTGCTGAACGGG
CGGCTCGGCTACTGCAGACTCGTGCAGATGAGCAGCGACGTGTTGAGGTTGCTCAGACGGAATGACGGTCTGGAATTGGATCACAGCGGGGTACATGGCA
CTCCTGAACATCCTGACAGTCGATGGGATAATGCCGCTTAGATGGACAACTGGATCGAGCGGCAGGCGAATAACTGCGTTCTTGGGCCACGGGAAGTGCT
TCAAAGACTGCCGCATCTTCTCTTCCTTCTGGTCCTTCTTGCCCTTTTCTTCTCGAGCCCGATTGTGGATCGACAGGATATGCTCCATAAACTCGCGCTG
CTGGTTGAGCATGTCAAACACGGCCCGTTTGTTCTCGTCGCGCTTCATCTCCTCCAGCATCTGGTTGAGGACAACAGAAAAGATCTCCGAATCACTGGTC
TGGTCGCTGGCTTCAACTTTCAAGTACCAGTAGACAAAGTTGGCCATCTGGAAGTCGGTGCCGGACCGTTGAATGAGGAACCGAGCCAGCGGTCCCAACT
TCTCATCCGACATCGACCCGTCCACACTGCCTGCATCGTCGCCTCCACGAAACGAAGGGGGCAATGACGCTGGAGCCGGTTTCTCATACCGCAGAGCCTG
AACCAACTGCAGCAGAAAGTCCAGCAAGTCTTCGTTCTTCGCCTTTGACAGAGTCGCAACAGCGAAGTTGCGCACGATCTCATGCTTGAACTCTTTCTCT
CTGCCCAAAAGCTTGAGTGCGTCCGCAATGTCGATCTCGCACCATTGGTGCAGCAGCTCGGTCGCCTGCGTGACCTCCATCTCGTCTTTCCAGTCCACAG
AAAGCAGGAACTTGACCAGCGCCTTCTTGTTGTCCGTGAGCGTGTACCGGAACTTCCACAACAGATCCTTGTCTTCGTTCTTGAGGTTGTCTGACGGCGT
GATCAGTAGCTGCTCGATCCGGGCCTTCTCGTCGCGACTTGGCTTCAGGTTCGGGTCGATAGAGCCGCGCAGAATATCGCGCGCCAACCGTCGATACTTC
CGCTCTGCCGGGTTGTCTTCGTTCAGATCAGGATCCCACACTGAAACGAGTCCAGGTGAATCTCGCGACGATGTAGACGACTGGGACGGCGCCGACAGGT
CGTACGTTCCGCTGAGAGAGTAGGAATCAAGGTACGGTTGGGGTGGGGTGGCTGGCACAGGAGTCCCACCATACTGGTTCAGTCGTCGCGCACCCATATC
CGCTGAATACGAGGACGTCAGGTTTCGCTGCGAGTACGGCTCTTCCTCGTACACTACAACGTCTCCGAAGTACGGCATCTCGATCCACAGGAGAGCGTCA
TCTCGGTAGGAGCAGAAGGGTCCCAGTGGGTCCTTCTTCCCCGGCGGTTCGCTCCCGCGTCGGATTCGGGCGATTCGTCGGTCGGTCACACTGTCCATCC
ACTCGTTGCGTGTGATCTCCTTTCGTTCGTACTTCTCCCGAAGCTTGTCTAGGCGGAAGCACTCCTGTCGGACCCACTCGTCGTCGATCTCGGACGGCGT
GTTGGTGGCCGGCGACGAGTCCGCCTCGACTCCCTCCCAAATGCGCAGGCACTGGACGCCGTCACGGAGCACGCCCTGCTTGGTGAAGAACGAGATCGTG
GTCCCGCCGATGGGGACCCAGCCGACGCCCCAGATCGTGATGGCCAGCAGCGAGTTGCGCGACAGATCGCGGTATCGCACGGGAAAGGAGACCCACTCGT
TCCAGTAGATGGTCGACTCGCTGCACTTGGTCGGCCCCTTCGAGCTGTTTCGCACAGGCACACACACGGACGCCGTCCATTGAGCAAAGCAGCACGCAAC
TCGGCACACAGACACCCCAGCGACCGTACCTGATCACCATCGGGTGCAGCGCCAAGCCGTCCGAGAAGATCTGCGCCGTTATGAACATCTCGCTCACGGC
CGCGTTGCGAAAGTCGGACGACGTGCCCGAGAGCTGCTCGAGCCCGCTGGCGCGCGCCGCCGAGCCATCCCTGCCATCCTTGCTCGCCGAGTGGCCGATG
ACCGGGGAGAGCTCCACGAGCGAGATCTTGATCGAGATGTTGGTGCTCACGCCGCTGCTCAGGTAGTAGCGGTACTCCTTGAGCCGATTCGCCATCATCT
CG