Description :
From Genome Similarity Track
Location :
contig_69:14864- 17177
Transcript NameFunction/comments
g11622.t1hypothetical protein

Sequence
2313 bases(100 bases per row)
TGTAACCGGGTACACCGACGTGTACCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTGTGTGCCCATGGTACGTGGTACCGGTTGGCGGTGAGCCAA
CCATTGGGCACTTGTTTAGCTTTTACTATAGTTGACTTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAATATATATTCAGTCTTTAAACCTACCGT
CTAAGTCGTAGTCGGTTCCCTTAGACCGGGAACCGTGAACTTGTTGTTCACCGAGAGCTTACGCTTTCTAGCACTTCCTCTGTGCAAGCTGCTGTGTGCC
CCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGAACTACCTGAATCCTCTGTGATCTCAAAGCCTGAGCCACTATGGAAC
GAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCCAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGTCCTTGAC
GGCAGCCGAGCAAGTCGAACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGAGAAACCTGGAGGCCTCTGTGGCCGAGCCGAAGCCTGT
CCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGAAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCCATGAGGGCG
GGTCTCATCTCGGATCAGGGACTTCGCATTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGGCGTACACGCTGGAGACGACGTCTCCTG
AATGCTTGGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGGGTTTCGCCAGCGCTCACGCTTCCTCGCCTGTAA
GCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGACGTCAAGACGACGGTC
TTCATGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGCGCATGCATCCACTATGAAGGAGGCGGTTAAGATCGCCCTCCAGGAGGAGT
ACAGCCATAAACAGGCTGGCACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCTAGAGCCTATGGACTTGAGCTCTGTTGAACTTGGCTCGGT
CGGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGGCCTAACGGT
CGCTGGCGCAAGCCGCGGCCAGGTGGCCGAGGGAACGGCGGCCACAAGTAATGGCGGCTTCCCCAGAGGGGGGAGAGTTGAGTCTCCGTGACGGGTGTGC
GGGTAGCGCACACCATGGAGGCTTAGCCTACGAGAGACTTTATGTCTCGAATCAGGTGATGGCAACGCTGGGTTGCCAGTAGTACACGTGAGTGTACGGG
GGTGTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGTCGAATGATTTCGTACGCCGGAGCGATTGCCAACTCTCTGTGAGAGAGCATCGGCAATGGTC
TGCGTAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTACGGCGTCCGCTTGGGTGCGCCGTGCCATGGAC
GCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCGAGGCTAGCCGGCACCCAGCCTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCAGA
ACACACGGTATCCGAAAGGATTACCTGGACGCAATGGCGTCCGCCGACTTAAGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAAGTGTTGAGATACCGTC
CACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAAAGCCCAGCGAGTGGAGCTGCAACGCCAGCAGCACCCACCGCTCCTGATCGTG
GCGCCATACAGGTCTCGACTGTATCGGCGCCAGGGGATGTAAGTCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCGTGGCCAGGGC
TGAAGTTGCCGAGAACACCTAACCATGTGCCACACGGAGTCGATGAGATTCCCGACTCTGTCCTTGAGTCACCACCGGCCGTGGGTAACGAAGAACCACG
TCGGGGTAGGCATTGACGACGTCGTCGCCTTCGTAAGCCGAGTCTGTTGAAACAGACTGGAGTCGCCACAAGCGACTCGGAGTAATCAACGCTCCTCAGG
CACGGCCGGCCGA