Description :
From Genome Similarity Track
Location :
scaffold_550:14863- 19820
Transcript NameFunction/comments
g9166.t1hypothetical protein

Sequence
4957 bases(100 bases per row)
TGTTTGGGGTGAAATGGGAACGCAACCACGTTGTAGCTCTCGATTTCTCGGAAAACGGACTCACAGGGGAATTTCCACTCGATATTGTCCGCCTACGCTT
CCTCATGACGCTCAAGATGCGAAACAACCAGCATCTACGAGGAACTTTGCCTCGAGAAATCTACTCGATGCCTCACCTCAAATATTGCTATGTGGACGGC
ACGGAAATTGAAAAAGCACTTCCATTCAACATCGCTCACTCTTTCCAAATTTCTCAGTTGAAACTTAAATCCCGCAGATCTACGAGGACAACGAAATCGA
CAGTGAGCTTTTGCACGGGTGACGAGCGTTCTGGTAACACCATCCACTGGATGGCCGACATGACTGAAACGGAAATGGAAATGGTGCGTTCGACACTCAA
GAAATTGCACGAAGACGCTAATGGTCATAAAGGGCGTGAGCAGATCAAGTGCACAGCTAGTAACGCCACTGGACCTGAACGTGCTGCAGCTGCTGTGAAG
TTACAGCGCATCTACCGAGCTCGTATCGAGCGGACAAAGTTCCGAACCTTCCTCCGTTCGCTTGTCGAGATGAAAGTTGACCCTGCAACTGGATCCAATT
ACTACGTCAATGCTCGAACGGGAGAAGCAACTTGGGAAAAACCCAAGTTCCTTGCTTCCGATACTAAAGAACACGCAAATATCGACAGTGATAGCGCGAG
TAACAACGTGTTAGATGAACGAGAAGTATGGAAACCGTACGATGACGGCTACGGCAACACGGTACGTGGATATTATCTTACAGAAATACTGGAATGTTCA
CTAATATTTTGCCAAACAGTACTACTGGAATAGTGTGACAGGAGAATCGACGTGGGAGCCTCCAAGCTTCCTTAGCCGCATCTACGAAGAGCTCCGTGAA
CGCTACGGAAGTGACAAAACGGATGAAGAGCGGTTCGATCTCTTTTTCCAAGATATCGATCGTGATGGTACTGGGGAAATCGACCAGGACGAGTTTGCTC
GGTTGTGCGGCGACTTAGGCATGGCTTTGTCAGCCAAACAGATACAAGAGGTCTTTCGAGAGCTCGACACTAGTGGCGATGGCCAACTTGATCGTCCGGA
AATCATCGCGTGGCTGACGCGAAACTTTAAATGAAGACTTCAAAGTACAAAATCCTACTAAATTCAATACTCAATAACAATGTTCTCTCTATTCATCATC
ACAGAGGAGCTGCAGCAACTTCTCGGAGTCAGCGATCGTACGCGTCAAGCCAATGATCTGATTGCCGCTGATCAAGTACGTGTCAGTGCAAGCACACTTG
ACTGCTGGAGGCTCCGAGTCGTCCAAGTCTGCGATCCTTTCTGATCTGCGGAAAGTGGCATCGAACTCCACAATCACTGAGTAACCAATGGCTTGGATGC
TCTTCTCTTCGACGGAGAGTACATCCAGGCACTGCTTAAATAACGACGCGTATTTGATGATGCCTTGGTCGCCATGGTAAGTCCCCCAAAACGGCATCTC
CTCAGGAACTTCGGACTTGAGGAAGAAGCTCGCAGAAGTCATGGGCCCTAACAAGTTGATGTCTGGGATCACCAGATACGGTCCACCGCGGTTCTTTGCC
ACACACTCCACTAGAATCGTGTTGGCTGCTTCGTCGATATCACTGAAGCTGTTCCTCGACGTCCGTGTCCTGCTAACAGCGCACTGCATGGCCTCAAACC
ACCGCATCCTTGTTGCGTCCGAACGTGTCACGAAAGTCAACGTTTCGTCTTCTTCGCGGTGACCGTCGAACACTTCAATCTGGAAGCCAAATGCACCTCG
ATCTGGCCTTTTCAAGCTCCGACCGAATGCGATCCACTTTCTTGCGTTGCAGACGACCAACTTCTTCGGTCGTGACGTCCACGTCTGCTTCTGAGCCATA
AAGAACTGCTTCAGCATCGAAGCTTTCGACGGAGAAGTGGCTTTAGAGGCTCCGTTGCTCGGCGAGCCTGATTGGACGTCTGCGGCGTCTTGCAAAGTCA
GCTGACAGGTCGATTTCTCGAACTTAAGGTGCACCTTTGCCCACTTCGAGCGCTTCTGGTAGGCATAACCACTTACAAAGAAATCATCTTCCGCTACATC
GAACGATGTGGACGCGTCTGACTGTAGAATGTCAAGAATGGACTCCGGGAACTTGCTCTGGGATCGACTCTGAAACATGTCGCTGGGGTGGACTGCTTCC
TTGCCTCTTGCCAGATTATGGGACGAGCCAAAGCCTTCCTTCTCCATGGGCAACCGTCGAAACGGCTCCAGCTCTCGTGACAGGTATTCACTTGCTGAAG
ACGACGGCCGAGCAAGCAAGAAGCCCGTGTCAGCATCGTCTTCACTCGTATTCCGCTTTCTGGGGGTCCCGTGGCGACTGCTCACCGTGACAACTTGCAA
TCCAAGAAGCGAATCATCAAGAGCATCCATTTGTTGGTAATGCGTGGCCACAAGAGAAGCCGCAAAGTCGTTCCAGCCCTTCACGTTGTTACAGAACTGG
CGAATTAATTCCTGCTGCAGTGTGGGCGAGCTGCAAATCTTGGCAATTTTTACGCCAATAATGGCCAAGTGAGCGTCGTAAATGTGCGTTGAACTGTTCG
AGCCCAGTTTGCGCAGAATGAACTCCAGAATCGAGTCGGGCGAGCGGAAAACACTTCGCAGCAGCGGGTTGTTCACGCGCCCGTTTGTAGACGGTCGATT
CAGCAGGTTCAAATAGAGCTTCACTAGGCGGCAGTGCAGTATACTCGCCTTCGGGAACTTCTCAAACACGTCCATTAGCGACGTCGCGAGATCCAGTCGG
GTCAAACGGCTATCGATACGATCCTTCGACATCAGAATGACGGCATCCAGTAGCTCCACGACGTGCATGACAAGCAGAGTTGATGCTAATGGTCGGTGGT
TCACCACAGTCTTTCCGGACCTGGGCGAATAGCTGAGAGCAGGAGGAGTTATCCCCATATAAAGCGTACTTCGTGCAGGCGATGCGTCACGTTTCGTGTG
CTTACTGGGGCTTCCTTTCCCTGCAAGAGGCTCAAGATCATCGCCGTTCTCTGTGCTGTCGTCGTCTGAGTCGCTGTCGCTAAAGCAATCACGCGCAGCG
AATTCAGATATCGTAGACAAATGCTGGTGGTAGTTGATAGACGCGCAAATTGTATCCAAAACGAGATGGATCGGGGCGACAAACGGTTCCAACTGCTCCA
AATCGTGCCGAGAGAACTCAATAGCATGCCGTACGATATCAATCACGAGAACGCGAGGGATACAAGCTCCGTTCATGTGGTGCGCGTCCAAAAATCGGAG
TTCGGCCATTCCGAGCTCAGTCAACCGAGCCAGGATGGTTGAATTCTCTGTCAGAGCAGCCAAAATTGCACACTTGAGCTTATGGTGCATTGCAGGGTCG
CTTGGGGCCATTCTCGGAGGAAACAGCTCCTTCTCAAAGGATTCCACGCTCTCAAACGAAGCCAGTTGAACCTTTGTCTGGATGTAGTACCGGAACGTGT
TGGGAAACTCGTCCTTCAAGATCTTCGTCAAGATTTCAGCACATCCACTTATCCTGGCATGAACTGTAGATGTTGTGTTCGAGGTAAACAGCGACGGAGA
GAGTGGCGCCGTCTTGGAGGAAAAGAATGAGGATGGTGACACAATTGGTGATCCACCCAGTGACGATCGCGGTGATGTAGACGACGTTGATGATACTGTA
GACGTTGAAGACACAGAAGAAAGAGACCTGGTTAGTCGAGTAGGCACTTGCTCCACAATCCGTCCCACAAGGCAGCGAATGATCGGAAAATAATCAAAAC
CTCTGCGGATTGAAAGATGAATCAAGCCATGCAGCAATCCCGCAACGTCAGGGTTGTACGCATGTGCCGCAAGACGTGAGAGCAGCCACTCCTTCTCCTC
ATCGTCGTTCTCGTCACAGATCAGTCTGTGCACCGCCGGGAACGTGACGAAATTCTTGGTGATCCGACACATATTAGCGGCCAAAACTCCGTCAACTTCC
ATCTCCTCATCCATAGTGTCTCCGTTCTCGACTCCATCACTCTTCTTCGACCCTAAAAAGCGGAACAAGCCGCTAAAGATCCGTTTCCACTCGTTCGCTG
TCAGATCCTCGAGTCGCAACAAGTATCCGCGCGTGGCTGGGTCTTCCAGCAATTCTTCATCTTCCTCACCGTCCACACTAAAGTCGGAAATGCTGCTTCC
AGAGCTCTCGAACCTCATACTCGCCCGCAGCCGCTGAATCCTCGCCATTTTTCTAGTCGACGCATTGCTCCTGAAGTCCATCATAGTCGGTAGGTTGGTA
GGTAAAGCAGTAGTCGACACGGCCAGTCCTTCTAACTTCACTTCCGGCTGTCGAACAGTCTCCACTTCAATTCCAGCATCCACCTGCTCATTCTCGTCCT
GTTTAGGCTCTCCGTACCAGGCCATTGCCTTTAGATAAAACCTAAGGATAATCTCCGTGGCCACATACGCCTGTCGGTATTTTTCCGGATGTTGTTCTTC
TGTTCCATCCTCATTAACCTGACTGTGCAGCTCACTGAAGGACGTAGCGTAGCTGAATACCTGTTTAATGGACTCTGGCTCCAGCAGCAGCTTCTGAACA
GGAGAAAAGTGGCCCCTCTCTCTCCTTTGCACTGTGGCGAGCACTGTGTCAACGTCGTAGCAGCTACAGAAGACGTTGTCCAGCGCTGGAGCCTGTCGAA
GAGCCTCCGCATTGTGCAGCGCCTGGGAAGCCTTCAACGGGTCGTGCGTGTTCCTCGTCAGCTCCAGCAGCGACAGAGACTTGGCCCAAGGCGTTGGCGG
CAGAAATGGCACAGGACCTTTTCCACTTGAGGCTTCGGAGGCCTCAAAAGCGGCCGGAGACGACGTTGTGCGAGCAGTTTCGGGCAAGAGGAGGCTTCCT
CGCTCGCTCTCGTTGTCGGAGTCGGACTCAGTCTCGGCCGCGCACGTGCATTGGCGC