Description :
From Genome Similarity Track
Location :
Scaffold_888:14862- 17286
Sequence
2424 bases(100 bases per row)
tgcgtTACTTCGCAATCTTCGTTGACGAAGCTAGCCGATTCTCGACACCGTTTCTGACGAGGAAGCGGTCAGAAATCTATGAACAATTTGAGTGCTCGTG
TGAAAACACAAAAAGTGCGGATGAAGGAGATTCGAAGTGATAACGCTCTTGAGTTGGGCATCTTTCTAAGCAAAGGTACGGAATGGAGTGCTCTTTGAGT
GTGAAACATACTTCAGAACAAAAAGGAGTTGCGGAAAGATGATTCGCCGAGCGGGTGCAATGCATGCTGGTTCATTTTGGATTACCCAAACAGAAgccgc
tgtcactgctgcatATTGTGTGAACATCGTACCGAACTCAATAAGAGGAATGGAGGTGCCGCATGCAGTGTGATTTCGTCAAACACCTACATACTCGAGG
CGTCGAACATTCGGCTGCAGTATTGGCACATACTGACAAGGTTGAGCGTAAGAATATGGATGCTAAATCAAGAGAAGCTTTTTTGTTGGATATTCTCGAG
AACAGAGAGACTATCGTCTACTTGATAGCAAGTCGAACAAGTCATTTTATAGTCATACAGCCATCTTCTACGAAAATAAGCTGGGGCGTATCCTCCTAAA
GGATGGggcgacaacaacagcaaatgTTCCGACGTCTAGTACTTGGATATTGACGCTGCTACCATGCAGAATATTCCGTCATTATTGCAAGAAATCCAAA
ACGATGGGGAAAATGGGACGAAGTGTGGAACTGGCGGGGCTGACGAAGGTGTTATTCGAAGTGAGACCGAACTTGAAAGACGAGACAAAAGAAGTCGAAT
AAACGATGATGCATCGAATGATGCAAAGGTTTCACACAAGCGAGCACGAATTGTAAGCAAAATAGCAGTTCAAAAACTACAGCACCAGTGTGTGAGGTGA
CAACGCCAAATACGAAGACCCCCAAAATAAAGAAGCAAAGCAGTGGGCGGTGTAAGACACCGACTATAGAATCTGGCAATGAGGACAGTGGATGGTGTGT
GAAACCGACTGCAAGACAAGTTGACAGAGACAGAGAATCACTTCGGGCTTCTGCTCTGATGCCTGGTGGCATAACGACCACCAGTACAGAGAAGCCTAAT
GCAGATGGTGAACGAAAGATGGAGCGCCTGACAGCCTTCAGTCAACAAGATTCACCACGTAGCAAGGTGTTGAGGACTGGGTCTATCAGCAAGTGTCCTC
GTTGAGCCAAAAACACTGAACGAAGCGATGAACAGTGAACACGGCAAGGGGTGGCGAGAAGCGACAAATACCGAATACGCTGCTTTGATTAAAAATGGTA
CATGGAAGTTGGTTCTTCACAAAAAGGTCATAAAAATGCTAAGTAATTGATGGATACTTCGAGTGAAGTATCTTGCAAGTGGAGACATTGATATTTTCAA
GGCCAGATTGGTAATTAAAGGATCCATGCAGATCTACGGAATTGACTTTCTCGAAGTTTACTCGCCCGTAGTTCGACCATTGCCGTTTTAAATGGTGGca
tcgatgttgaagtgtaTATGGGGCAACAGGAAGGATATGTAGAAGAAGGTAAAGAAGACTGGGTCTGTCTGTTGCTGAAAAGTCTTTATGGATTAAAGCA
AGCTCCACGGGTGTGGTTCCGTCTGCGAAAGTTTACTTGGTAGGAGAAGGATACACACTCAACTGCGAAGCATGTGTTGCCGTGAAAGTGATTGACAGTT
GGCTTGTATTCATCACCACCTACGTCGATGATTTGATACTGTTCACACCTAACAAGGCACTGATGAAACAGCTGAAGCAAGTGCTCCATAAGCGTTTTGC
AATGAAGGACTTAGCAGCAATTTCATTATATTCTTGGTTGGGAAATTATGCGCAGCAGATGTGATCCGACTATATTCATAAACCAACGCAAGTATGCAGA
CAAGGTGCTGCGCCATTTTAAAATTGTAATGGTTGTAAAGTGCCAAGCACTAGagacttgaagttgtcgaaAACCATTTTCCAGTCACGCGAGAGGAGAA
AGATTTGATGAAAGGAAGCCCTATCGTGCAGTGATTGGCAGTCTGCTATATTTAATGCTGGGCACTCGCCCTGATTTTCTTACCTGGTGCGAGAGTGTAG
CCAATTCCTAGAGAATCTTGGTGTCTTGCAATGTGCCGCAAAACGTGGCTTACGATATCTGAAGGAAATAATGCACTGGGGATTACGTTTTGGGTGTACA
CAATGGATAGAACAGAAATTGGACAATCACCTCAAAGCTTTGCTGACTTTGCTAATAGAGTTGACGATAGAAAATCTATCGCTGGATATCTCATCCAGTT
ATGTGGCAGCACCATTTCATGGTGCAAAGGACAGTCACATTGCACACTACAGAAGCGGAGTATATGGCGCTAATTTTACCCGTTCAAGAAGTCACCCACC
TTCGACAGATGCTGAAGGAATTAA