Description :
From Genome Similarity Track
Location :
Scaffold_72:14858- 18114
Sequence
3256 bases(100 bases per row)
GATGACTTGCCTGATCATTGATCACGATTAAGATTAATTCATCGTGGGCAATGCTGTTTTACTATCCCTGGGCATTGATGTCGACGGACAATTGGAGCAA
CTCGCGGGTAGCCGAGTGGCTGACGATGAGAATCCTTTTGCATGTGACCATGAATTTCATTTTGGCCACGCAAGCGACCAAGACATTCGCAAAGGGCGAG
AGAAGCTGTTCTCTGCAGCGATGGAAAATGGGTTTCCAGAAGAATGGATGAAGGAGCTTCGCCGCATCACAACGAAGCATGACATTTGGCGTTCGATTTT
GTGTGATGACCCGCCAACTAAGGTGCCTCCGTACAAACTCCGCCTGAAGCCAGATGCAAAGCCGTTCCGCTGCAAAGCTCGCCAGTACGCGCCACTGCAG
TGCACGTTTCTGAGAGAATTCAACAAGACACTCATTGAACTTGGCTGGGTATACAAAAATCCCAGCAGCCGATGGGCATGTGCAGCTTTGCCTATCAGGA
AACCGAAGGTGGATGAATTTCGACAGGCTGTCGCCTACTAACCTCTGAACGCCATGACTGATGCGATTGTGGGCGTGATGCCAAACTTGGAGACCAAGTT
GGAACGGCTGCGGGGCAAGAAGCACCATGGCTTGTTGATTTTATTCGGAGTTTTGGCAGCTTGCTGTTGCGATGGAGCGCCGGGAGATGCTCTCCTATAT
GACAGACGAAGGCGTATTCACTCCGGCTCGCGTGATGTCAGGCAGTTGCGACTCTGCTTTGCACTTTCAAGTGTCGATGGAGAATTGTTTTGCAGAGCTG
TTGGAGACCACTTTGCTCATTTGGGTCGATGATTTTTTGTTCAATGCTGATACGATCCCGGGGTACCTTAGTGCATTGGAGAGACTGTTTGATCTGGAGC
ACGATTTCGGATTGAAGCTTAGTCtgaagaagtcgtcgctgtacCAACGATCAGTGACTTGATACGGCAAGATTATTGACGAGAACGGAGTTCGTCACGA
CCCCAAACGAATCGGAGGCCTTTCGACAATGCCACAGCCCACCACTGCagggcagctgcagcagttcatcTGTGCAACGAACTGGATGCGTGGCAGGCTT
ATTGACTATGCTCGCGCTATTCGCCCGCTGCAATTACTGTTGGACAGATCTCTCAGTGGAAAGCGGAAGACAAAGCGCGTAGCTTCGGGAGATAATGTTG
CCCTGTCAGCTGAGGAGCATCACAGTTTCAGTCAAGTGAAGCAGCTATTACAACAATCAACCATGCTGACACACCCGCGGGATGGCGCCACGTTCTGCTT
GTTTGTGGACGCGAGCGACTGCGGATGGGCCTCCATTCTTACACAAGTCGTGGAGTGGAAACACGGCGTGGCAATTACTGAGCAGGCACAAGAACTACTA
GTGTGTAAAGGCAGCGCTTTCAGCGGCGCGCAGTTGCACTGGAGCGTCATTGAGAAGGAAGCTCTCCCAATCGTGTTGTACTGTGAAGACCTCGACTACT
TGCTTTTGTGGCCCGGTGGTTTTAAAGTGTTCTGCGATCACCGAAACCTGATTCATAAGTTTGCCCCAGGGCAAGAAGTGAAAAAGCCTGTACGCGGCAA
GTTGCTAGGTTGGGCGGTAAAGTTTATGGAGTTTCGGTATACGATTGCTCACATCGAGGGGGTCAGCAACATTTGGGCGGACATGGTTCGTCGGTTCGTC
GGTGGGGTGGAATGGCTACGCCAGCAAGGACTACCAGTACCGCATCTAGTTTCAAGCGAGTGACTCGCTCGCAAGCCCAAGCTGCTTGCACACCTGTTCT
TCGACCCCTCGACCAAGATGGCTTCAGATGGCCAACCTTAAGTGAAATCGCGATGGTACAGGCAGCTCATGTGCAGTCAGCGCCAATAGCTAGTGTGGTC
GATTTACATAGTGTACATCGAGTTGGCGACACTATCTGGATTCCTACTGCTGCCACGTCTCTCATTCAACGCCTCTTTATCATTGCCCACTGTGGAGCAC
AGGGGcaccgtggagaagctgtggTCTAGAACCACATTCGGCGGGTGTTCTCGACGGATGGGATGACGAAGCTCCTGCGCCGATTCCTGTGTTCTTGCTT
GGTGTGCCAGCACGTGAAGGGAAACAGGGTAGTCCCACGACCATGGGGTGAACTTTACAGTTCTGACATTCGCAATGGAGCTTTACACTGGGATTTTCAA
CACTTGGGTGATGGATTTGGAACCTGAAAGTATCTGCTTTTGTTAAAGGACAATTTCACGCACGTTTGCGAATTGGTGCCGTGTGACACTCCGACTAGCG
AAGTTGCTAACGATTCTGTGCTCGGCTGGCACAGCAGGTTTGGTGTACCACCAGTTTGGGTCAGTGACAATGGTTCCCACTTCAAGAACCAAGTCGTGGC
TGAATTATGTAAAAGGCTGAAGAGTCAGCAACAGTTCGTAGTGGCGTACAGTCCGTGCATGAACGGCTCAGTGGAGCGAGAAAATAGAGATGTACTGCAA
GTCTTGCGCGCTATGATCATGGAATACCACATTTCGCACAAAGACTGGATCTATCTAGTGCCTTTGGTACAAGTCAACATGAATCACTCTCCAGTTGCAT
CCCTTGCAAACAAAGCCCCAGTAGAAGTGTTTACTGGACTTCCCTGTCCTGTTCCCGCCTACGTGTTTTTCGTACCCGGTCAGCAACCTAAGGACTCTCA
GGCTCGAGTGGAGACGTTGAGCGGTCACTAGCAAAGTTGCGTTCCAGTATTGAGAGAATGCATCGTGCCGTCATCAACAAGCGTGAGAAGTTCACGATGT
TCAACAAGAGAAAATCCAGAGGTGCACAAGAAGTAAACTTTTCGGTGGGTGATTACGTTCTACGATCCAGTGTCGATGAGCGACGACACAACAAACTACT
GGTGACCTGAGTCGGCCCCTACGTTGTCACTCGTGCCAATTCGCACTCATTTCGTATTCGACATCTCATTACGGGTAGTGAGCAAGATGTACACGCATCT
TGCCTAAAATTCTATGGGGACAGCGACTTGGAGGTTACAGATGAGCTTCTAGAGCGTGTTGCAGCTCAAGGCATCATACTCTAGGTCAACCAACTGGTGA
AGCACTGCTGGAATTAGAGAGCCAGAGCTTTGAGGTGCTTGTGAGCTGGTGTGGACTGGAATCTGTCGAAGACTCATGGGAGCCACTGCAGTCACTCGCA
CAGGATGTCCCGGTGCTTGTACGTGCCTACGTTGAGGCAGCCAAATACGAAGATTT