Description :
From Genome Similarity Track
Location :
Scaffold_70:148544- 168003
Transcript NameFunction/comments
Phyci_522264Hypothetical protein
Phyci_231987Hypothetical protein
Phyci_522307Hypothetical protein
Phyci_231819Hypothetical protein

Sequence
19459 bases(100 bases per row)
GAGATTTTATTCTACCAGGACCTCCACAGGTCAATTTAGAATCTGCATCAGGAGGGTGCATGGCATTGGGTTTCGAGCCTCCGACTTCCACAGGAGGAAA
CGACACAACTTCTTTCCAGTATATCGTCATAATATATGGGCCCAGCTATGTTTTCGAGACATCGTACAATGTTACCTCCAACAGTCTTGATGCATGCGAC
TTACATCACGATACTACCTATGTGGTTAGCGTTGCGATAAGCACTGGGAACGGAATGGGAGAAAGTCAAATTGTTAACGTGACAACTGGAGCGCTTACAG
CTCCAAGCGAAGTAGTTGGATTGCTGGAAGTCACTACTACCAGTGGGTGTTCAACGATATCGTGGAATGCCCCGCTCGATAAAGGCGGAGTGTCGATCGA
ATTTTATGAAATTGCTGTTACCAATCACGCATCGAACGGTGTTCAGTATGTTGGGGTGCCTGGTTCAGAGCTGACAGCAACAATTAGCTTCTTAGTTGCG
AGTACATCTTACTCATTCTCGGTGCATGCGGTAAACGATGGTGGTCTGGTGGGCCCTGAGTCAAGTGTCACTGTATCGACTGGAAACGCAGTAACACCCC
AGCAACCCCCTCCACCTGAGCTAGTTTTAGCTACAGGTGGAGCGTTGTTCGTCACGGTGGTTGCTCCAGTAGACTGTGGTGGTTCAGACTTGAGTTCGTA
TATTTTAAACATCGCTCGTCATACCGGAGGAGAAATTGAGTATCGTCAATACGCTTCCGGTTCCATCGAGAGTGTGCTCTACGACAGACACGTAGCAAAC
GTTTCGATCTACGGACTTCTATCAAAATCCGAGTACTTCATTACAGTCTCCTTGGAAAATGCCCAGGTAAGGAGCTGGATGCTACGTGTATATCGTCTCA
AATAGTTCTAACAAAGTCTCGTTGATTATAGGGATGGAGCGGGCCAAGCGAGGAGAAAGCCTACTCAACCAGTGGCCCGACTCCTGTTCGCGGAATGGCT
CCGCCGATAGTTACATTCGAGGATCCTGGCGAAATTACGCTGGAATGGACTACGCCATTGGATTCAGGCGGACTTGGTATTGTGGGGTACACGGTGCAGT
CACGCCACCAATTGGCCGATGGTTCTTGGTCACTCTCGGAGACTGTGTACGACGGTCGATCATCCTTGGAGCAGACAGCTCTGATCACAAGCATAGTTCA
GAGTACTCAGTATGCCTTCAGCGTTACGGCTTACAATTTCCGTATGCTGTGCCGACCCGATGAATACGTGACACCAAGCGACGAGCTTGTTATCAAAAGT
CAGGACGCGTCAATGCCTTCACTACCGAAAAACTTTCGCTACGTACAGGTGACTGGTGGATCCATTACATTAGCGTGGGACCCTCCTCGGTCTGCAGGGG
CGCAGCCATTACTCTCATATCTAGTGAATGGGAGTGTGGAGGGCAGTCAGTTGGTACCCATGGCGAATATCAGTGTTACAGCCGCGACCTCAGTTACGCT
TTACGCCTTCACTGCTCTCACAGTTTATGACTTTGCGGTTGCTGGAGAAAATGCATTGGGGGTTGGCCCATACACTTCCTTCTTACGCGTTAGTACAACG
GCCGTCAGTGCTCCAAGCCAGCCGAAGAATCTGACCCAAATACTTGTTTCTTCTGGGGGGACAATCGAATTGTCCTGGGACCCCCCAGATGACTCAGGAG
GTGTGCAAGTGCAGCAGTACACGATACTTCGCGATGAGAACGAGGTCGGGGTGGTAACCACGTCGACATTCGTCGACCAAAACGACGTGGAAGCAGATAC
GAGCTACAATTACGTGGTCTTTGCGTCCAACGATATTGTATCTGGTGCAGAAAGTGCTTTGCTCGTCGCTCATAGTTCCGTTGCGTCAGTTGCATCGCCA
CCTTTGGCTACGGCAAAGGCTGGTGGCGGATATGCCGTGCTGACGATTTCACCTTCGGCAGACTCGGGCGGGTCTCCTATTCTCTACTTCATGATCACGG
TACTGCGGGGAGCAGTGTTTGTCGACGTTTACAACTGTTCAGACACGATATTCACTGTACCAGCGCTCTATGCCGATGCACAGTACTCCGTTCGCGTCCA
AACCGTCAACGCTGCTGGGAACAGTGACACCACCACCTTAAATCTTTCGACTACTTCTGCTACTGTACCCGACAAAATGCTGGCTCCAAGTCTGGTGAGC
CGGACGGGAGGTGCCATCCGACTCGGAATTTTGCCTCCGGCAAACTTTGGTGGGGCAGAGATTCGAGGCTACAACATCTTTGTTAATGACAATCTTGGTG
ACGTGGTGAAGATTTCGACCACCGAGTATGACGTTGTTGGGTTAACGGCCCTTACTGCGTACTCAGTCGCAATTTCGGCAAAAAATATTGTCGGTGAAAG
TGACTTGAGTGATCCAATAGCTATCTCGACGACTGAGGTAACTGCACCCGGTATAGTTTGGAATTTAGACTGTGCCTTTGTATCGTACAATACGATTGAA
GTGGCATGGACGATGCCCCAAGATTTTGGAGGAGATGAATCAACCGTCAGCTATGAGGCTGAACTCAACTCAGGCGCTGCCAACTCCAGTATAACCTCTT
GCAACACAAACTCGGCCACCTTTTCCGACCTGCTGCCTGCCATAACGTACACGATTCAAGTCCGAGCACTAAATGGAGCAGGCACGGGTCCATGGTCGAC
GGGTTTAGACGTGATAACAGATCCTGTCTCGCCTGGGATCATCAGTTTTGCAACGAATGAAACTTCCGTTTCGGAAGCAGGGGGCTCAGTGAAACTTACG
TTGCTCCGCACAATGGGAGGTTATATGCCCGCCAAATGCAGCTTTACCACCGTGGACGGAACTGCAGTGGCTGACGTTCAGTATGAGGGATCCAACGGTG
AGGTTGACTTTGCTCGAAACGTGAGCTCGCAATGCATAGTTATCTCCATCATAAATAATGCTATCGCAGACGATCCAGACAAATATTTTTTCGTTTCGAT
TCAGGCGTATGACGATGAATCTGGGGAAATTGGCAATATTTCAACGATTAAAATTATAATCTTGGACGATGGAGATGCTGGTGTTCTCGCTTTTGATCAG
AGCAACTACACTGTATCTGAATCCGTGTCAACTCTTAGTGTGAAAATCGTTAGAACCCGGGCTTTTAGCGGCAGCGGGGATATTGCAATTGATACACTTG
ACCATCCTGGAGGCGCTGTGGCTGGCGTCGACTACAACGTCCAGAATAATGTCGTGAGTTTCTCGGACCAGCAGGTTGAAGCGACCGTCAGCATCGAAAT
TACCAATGATGCGATTTACCAACCAAAGAAAACGTTTCAACTGCAGCTTCGTGCAATTACTGGGCGAATCTCGGTGGGAGACCCTCCGGCAAATGCTTTG
GTTGGCATTTTGGACGACGGTGACATCTCGCCCCCCGGGCTGCCTACCTCTGTTCAAGTCGTGATAGTGTCGGGGGGAGCAGTAAACGTTTCTTGGTTGG
CTCCTGATTATTTGGGCGCGGAGCTGGTCACTGCAATGTCGTATAACGTAAGCGTGTTGGCAGTGCAAAGTAAAATTACCCGCGAACTGTCTGTTACGAG
CTGTAGTGCAGCGATTCTACAGCTAGCAGCTCGAGCTGCGTATCGAATCTCAGTTGCAGCTGTAAACGACGAACTAATGGGCGACTACACAGCCCCAGTA
TCAGTGACGATGGGGGCTCCTACACCCCCCTCAAACCCACTGAATGTTCAAGTACTCTCTCGAACTGGAGGAATGGCAACCTTATCATGGACAGTTCCTG
TCGATTACGGTGGTGCTGACATTGGAAGTTACCGCGTCAATGTGACCAGAAGTTCTGACAATTTATATATTGGCTCCTATACTACGGACGATGTGATCGC
GTCCACGAATAATCTTGATCCACTCACGAGCTATAGCGCAACGATCGAAGCCATCAACAAGGATGGCCTCGCTGGCAATGCAAGCACCCCCGTCCTGTTT
ACAACGGTCGCAGCTTCTATGCCTGGGAAACCCGCCAACTTGGTGATAACAAAAACCACAGGAGGCGCGTTGTATATGTTGATGGAGGACCCAATGGATG
TGGGGGGATCCCCCATTTTGAATTACACTTTGCTCATGACATCCGCGCAGTATCCAACCATCTTCCGCCAAGTTTATCAAGGATCAAGTCCAAGTTTTAC
TGCAACACACTTGACTTTCTCTACAGTTTATATGCTGCAGTACGAAGTCGCGAGCGCCGTGGTACGTCCCCGAGGTATCCTCTAGAAACTAAAATTTGAT
GCTGTACTAACAATTGCTTCATCGTATGAATAACTGTGAATTGTAGGGATCAAGTGAATTCAGTGACGTATTTACCGCAGCTACCAGCTATTTATCGATT
CCCGATGAAGCCCAGAACATAGTCGCGGTCTCTCGAACGGGGGGATCCGTCACGCTTTCGTGGACACCCCCATTCGATTTTGGTGGAGCGGACATTACCG
TGTACGATGTGTCGTTTTTCCTCGGCCCTCCAGTCAGGTCTCAGTTTCGCCAAAGAGTAGCCGGTGTCGATCCAAATGCTGCCTCTGTAACTGCAAAAGT
TGTTGGGCTATTGGCAAATTCCTACTATGGGTTCTCAGTTGCTGGCGTGAACGATGCGAGTGTTTGCGAAGATCCCTCCGCCATACTACAACGCACGATC
GTTTACAGCAGCACGGATCCATTCGTCACTTTACCAGATACACCGCGCGGTCTAACCGTTGCCCAAAGTACATCTGGAATGCAGGTGATACAATGGTCGC
CTAGCGAGGATGCTGGGGGCAGTTTCTTCATCACTTATCTCTTATATTCAAACGACGGCTCTATCTTGTACAACGGCACGAATCCGACCTTCGCGCGCGG
ATCACTCAATCGAAGTACGCGATACGGCTATGCTGTTGCGGCGTGGAACACGGCGGGGACCAGCATCCAGAGCACGCTTGTGTTTGCGACTACTAATGCA
GCGATTGTTGCTCCAAGTCAGCCACTTCAGCTCACTCAGACAACCAGTACTGGAGGTTCCATTGGATTAACTTGGCAAATGCCCTTGGACAGTGGAGGCG
ACAAACTGACAGGGTACAAACTCTTTCGAAATTCGGTTTGGCTAGCGGATGTTGCTGCTACTGGGCCCATCTTGTCTTTCCTAGACGATCGAGATCTTAT
AGCGGATCAGCAGTACATTTATGTTGTTCACGCGACCAACTCGATTGGCTTGGGCGCGATGAGCGACAAGTTGACTGCCAGCACGGACGCCGCAACCGCT
CCAAGTTCACCAGATAGCCTTACTGTCACCTCGTCGGGGGGTAACCTTACAGCAATTTGGGTTCCAGCTGCTAATACCGGTGGTATTCCGTTGGGATTCT
TCAGCCTTCAGGTGCTGGTGAATTCGGTGGTGGCGTTCGAAACTAACATTACAAATACGTCGGTGCTGGCGTACTCTGTGTTCGGTGTTCGAGCGGGCAC
TACATACACCATTCAGCTCACTTCTGGGAATCAGATTGGAGAAAGCTTACCCATAGTTCAAACTGTGACGAACGGAGCCGCTCTTTACCCAAACCCCCCA
CCTGCCCCTGAACAATTCGCTAATTCAACATCATTGGCACCTTGGATGATACGGCTGAAGCTCTACCTTCCGATAGATGACGGCGGAGCACCGATTTCTC
AACTGCTGGTGTATCGTAATGACACCAAATATACTGCGACTTCCGTTGATGACGCGGACCAAGCAGTCCTGGGAGATCCGACAACGCGCTTCACATTAAT
CGATGTGGGGCCTTTGCATGCTGACTCCGTGTACTACTTCGCTGTCTCAGCTGTTTCTCCAGTTGGAGAGGGGGCACGAAGCAGTGTGCTTCTGGTGAAG
ACAAACGCTGCAACGCTGCCCTCTGTGCCGATCAATTTCGCGGTGGGACTTCGGACGTCGTTTTCAGTTTTCTTGCAATGGGGCGCTCCGATCGACACTG
GAGGGGACGAGGTCGACTATGAGATTTCTTACACCAACACGAACACTTCAGAAATTCTAGGGGCTACAGTGAACGACACGACGGTGGAGATACCCAAGTT
GGTTCCGGGGGATGTCTACTTGTTTCAGTTGCGGTCAAAAAACTCAGCGGGGCCAAGTAACTGGACACCTGGGTTATTGACTCAAACAGACGTGACACAG
CGCGGCTTCATCACGTACGCTGTTGCATCACCGACAGTCTACGAAAATGTCTCGAGTGTGACGATCGATCTGCTCCGTGTAAATGGTTCCGCGGGTACAG
TAACATGCAGTTACACAGATGGCTCAGGAACTGCGATTCCTGGTCAAGACTATTTGTTGCCCACTGAATCAGCTCGATCATTTTCGTTTTCCGGAGAACT
AACAAAGCAGAGTTTCAATGTGACGATTATCAATGACGACGTGTATGAACCAAACCCGCGAACGATTAACCTCATTCTTACAGATACCACACTTGGTCGA
ACTGATCTGATTCCGCCTACTACGATCACAATCACGATTTTGGATGATGGAGATGCTGGAACGATTGGCTTCACTACCAGTGCGATTAGCGTTCTGGAAA
ATGCTCGAGTGTTATCGCTAAGCCTCCAACGCCTAAATGGAAAAAGCACGGCAACGAGTGTCCGCGTGGTAGTGTACAGCGGGTTGAAAAGTACAACTCA
ACCTGAGGTTGGCTTCCGACTCCCTTCAGGTTCCATAGACTTTATCGATGGTCAAGTTGAGAGTGACGCATCTATTGTGATAAAAAACAACGACGTTTAC
GACTTTCCGTACCTCTACTTCTACTTGACTTTGGAAATAACAGCGGGCAAGGCTACCGTTGGGCAATATAGTGTCATTCGTGTTGAGGTTCTGGACGATG
GAGACCATTCCGTGCCAGGATTGATAAACGCGCCTACGCTCGTTAAGACGACAGGTGGAATGCTGACACTGACATGGTTTCCTCCCGAAAATGTTGGAGG
CCAAGATATCTGGATCACGGGCTACAATGTATCGATTCGTGTCGGCAGCTCTATAAAGTCACTAATCACTCGCGATAATGCCACGGAATTGCCGTATGGG
GGGCTAAATGTGCTCACCAACTACACGTTCTCGGTATCCGCAATTAATCCAATCGGATTGGGGCCCGGGTCCCCCAGTGTTACATTCGCGACGACAAACT
ACACAACACCAGTGGCACCCGCTCAGATTGCCCTAAGGAATCGAACCGGTGGCTTGATCACCGTTGATATTTCTGTACCTGCCGATACTGGGGGAACCGC
TATAACAGGGTACATCGTTTATACCGCCGGGACAGATGGAGATTACCAGGTCGGCAAAAAGAAAATCGGTGCTGGGGTTTGTTCGTTCGTAGTATTCATG
CTATCTGTTGTGTGTTCGTGCGATTAGATGGTGTACAACGGCACTGGACAACCGTCAACAGTGACACCGATTAGCGTCGACAAACCGGACACAAATTACT
CTTTTCGAGCACAGGTTCGCTCGATATATATAAACATCCGCTTGTTGAATAATACACAATCCAATTGATGACAATGTAAAACTGGTGGAATGACTGCAGG
CTATCAACTTTGTCGGCGCCGGTGATATGTCCGAGGAGTTTTATTATATGAGCGGACCACTATCACGACCGGGGCCTCCACGCTTCCCAGCTGTGCCTTC
TTCCAGGACTGGAGGAGCAATTTCATTAGACCTGCTCCGCCCACTTGACACAGGTAAGCGTTCATTACTTTCCTCAGTACAGATCTCGGACGTTGTAACA
TTGTATTTGATGGTTTGATAGGTGGTTACGAGGACATCTCGTACGTGATTTACTATCGCGAAAACGGGTCGGGGAAGCGATTTCGAACGACTTACTCACA
TACCAAGGGTTTGAGCATAACCGTTTTTCGTTTGGCAGCGAACACGATCTATGATATGGTTGCAGTGTCCGTTCTTGAGAACGACACGTCCCGGCTCACA
GGTGGGACGATTAATATCTCTGATTCCACCATCGTACTCAACGACAATGTGTCGAGTGAACTCTTGGCAAGCGGTAACTTCGAGTTTGACGTCAGTTCTG
TTCGTTTGCTTTTTTGTCAATTTATTTGGGAACTGACTTACGGTATGCTATGCAGGGGTTCATTTTTGAAATTGATCAAGGACAAGCTCAGTCCAACGGT
ACAATCACTTACTTGCCATCATTGAGCACAGATGACGGAGAAACAGAATCTACCGATCTGGAAAGTGGGGACGAGTATGATGTGTTTGTACGAGGAGCCT
TTAGCGAAGTGGCCAACTTCACGACTACATCCCCCACAAAGCCTGGGGTGCCACCTGCACCTAAACAATCTGATGATTATGATACCACCGGCGGTGCCCT
TTATATAGGGATCTTTTGGCCGGATGATACAGGTACGTGACTACTCTGTTATTCCCCAATACTGAAGGCTAACACAGAGTTTAAACGGAATAGGTGGTGT
TGTTATCACGGGCTACGAGTTTTACCTTGATAACCAAACGGTAAGTTGCCTGTCATACTTATAAGGGACTTGACTAAAACGAATACCATGCTTGAATCCA
CAGGTGGAAGGGAGCCTACTAAGTTTAAACCATGACAACGTCAACATGTTCGATTTTACCGCCACAGTGGAAATCGGCGGATTGACACCAAATACGAGGT
ATAGTTTCTACTACGTCCTCACCAACGACGCGTCTGCGTGCGGAAACGATACCGAAGACGCTCCGGAGCAATACCCATTTTCAACAGTCAACGCATCGAT
TCCGGACCCTGTGCCCGTGATACAGTCAATCGGGGCCACCGGGGGTGGAATACATGTGCAGCTAACGCCACCGATTGACAGGGGGGGCGATCAAGAGTTA
TATTACCATGTTTACTTCTCGGAGAGTCACCCGAATAATTGGAAGCTTGGATACAATGGCACGGATGTCTCTTATTGGCAAACAAACCTTCAGAAAGAGA
CCGACTATTACTTCAAGGCGACTTGCAGGAATGATATAGGTTTCTCCGTTGACTCAAATACGTTCAAGCTTCAAACAACTCTTATATCCCCTCCTGGACC
TCCAAGCGGCTTACAGTTTATTAATGCAACGGGGGGCACGGTTTGTTTTTCCTGGAAGAGCCCCGAGGATGATGGGGGCAGTGCGATAACCTCCTATTCA
GTACATGGGCAGGATGCCGCTGGTGATCCAGAGCTAGTAAAGGAAACAATATCGTCGGAGATAGTTTTCGGGGGTCTGTTGGCAGACAGATTGTACAACT
TCCAAGTGTTCGCGGAAAATAACTTGGGGACAGGGTCGGACCCCGGGACAGTAAGTTTTTCGACTACTGTGGCGACCTTACCATCGCTGCCAGCAGATCC
TGTGGTCGAGCAAATGTCTGGAGGCGCGGTTGTTTTCAGTATTCAAGTCCCACAGGACACAGGAGGCGTCAGCGTGGACGCCCTTGTATGGACCGTGTAC
GCGAATGGTGTGCAAGTCCCACCAGATGCTGTCCGTCGGCTACAAAGTTTACCCGCGGTTGTTACTGCCTCTACAACGCGTCGCCTGACATCAAGGAGAC
TGGCAGCAGATGGGGGAACGACTATTTACCTCCAAGCAGGAACGCTACTTCCATCCACATCGTACTCATTCACGGTTCAAGTAGCCAACAGTGTTGGAGC
AAGTCCTATCACAAACGGAGCGGAGAACACGACTTCAGTGGCTACTGTTCCCGGAGCGCCAGACCCACCTACAGCCACATATATCACTGGTGGTGCAATG
GAGCTTACATGGACCGACCCTGTTGACTCCGGTGGGGCCCCATTAATATCGTATCAACTTAGTCTTCAACGCCGGGGAGTTGAAGTGGGGCTTTGCGAAG
GGATGATTCGTTCGTGCGTCGTCGGAAATCTGCTCTCGATCACAGACTACACGGCAACATTGGTGGCTTACAACCCTGTCGGCGCGTCACCACCCAGTGC
GATTACTACTTTCACGACTAAAGTGATGTCGCTCCCTCAAGCACCCCAGGGTGTTCATATAGCGGAGGTGTCAAATACCACGGTGACAATTGACTGGGAG
CCGTGCATCGACTTCGGCGGCGGCTACGTCGAAACCTATCAGGTGGATATTGTACAAACACTGGACACTAGCGTTGTCTTTACAGGTAGCGTTCCCGTGG
AGCAGTTGAATTACAGCGTGAGTGGTTTGTCTCCCTCGACAAATTATAACACCACGGTGGTACGATGTTTTTATTTTCAAACTCATTCATTACCCTAGGC
ATGGTCTAATTGATGCTTCGTGTTACAGCGCGCTGTCACTGGTGATAATCAGTTGGGTGAAGCCAGCAAAATAATATTCTTCAGAACGCCACAGTTTGCC
AACCAGCCTCGCCCACCCTCAGTTGGCTGCCGTAAGGGCATTTTTGTGTTGGGTGATGTTTTTTTCACATGCTGAGATTTTATCGTGCCAATTGATGTCA
TACAGATTCTCGCACGATTGCAAACGTATTCTGGGAGGCTGAAGACGATGCTACTAACTATCTTCTGTACCGGGACGGGCAGTTTCTGCATGATAATGGG
GAAGACATCACGTTTGAGGACAGTATAACGCTCGGCATGACGTACTCTTACCAAGTTCGAGTGAAACGGCTGGATGGGAGTATAAGTGATCTAAGTGAAG
CGACTCAATTTTTCGCTTCAGTTCCTATCTCCAGTAGCTTCGATTGTGACGGAACCGAGGGATACATTCACTGGCATGACTACCACAACTCGGATCACGA
AATTTGGACAATCATCCCCCAGAATCAAACCGGCATTGTGATCACCGTAAGTTGAAACGCTATCTGATGTTTTGATGTTGAACGAGAGTATTCACGGTGA
AGTGTAACATGTTCTGTTTCCATTGTCATTTAGGCGGATATGTTTTGGCTTGAATGCAACCACGACAGTTTGACGATCAACGTGACAGAAAATGGTGAGA
TGAAGCAGCTTTGGAAGGGTGGATGTCACCGCGAGGGAGAGTTTATGGTGTCCACCGATTCCGGAGTCGACGCCGTGATTATTGCCTTTGCGTCGGATGA
GAGTGTTACCTACGACGGAATGGCTCTGCACTACGAATCGGTCGATGCACCTGATGCTGTAGAATCTGTAAACGTGCCATGTCCCGTTACGCCTAGTGGA
TTGTGCTCATTAAATGGCGGCTGTCGAATGGGGGCGTGCTCTTGCTTTAGTGGGTTTGTAGGGGAAAGCTGCACTAATGCTGTCATTTGCCCCGAAGATA
TGAGCACATGCACGTTATCTACGTGCGACCCCGTTTGCTTTCAGTCCCAGAGTGATGTGATTGCTGTGAGCGTCAATGGGGATGATACACAGGGAACAGG
GCAGCTCATGGACACTTCGTCAACCAATGGCACCGATCCAAAGGCCGTTCAATCGCTCAAACGCGCTCTGGAGCTGGTGACATCCCGACAAACAATTTTA
CTTTACCCTGGAGTTTTCGTTGGAGCTGGGAACTGTGATGTTTCAATATTCATTTCAAAAATTCTCATTCGCGGTTTGAGAGGGCAAACAGTGACAACCA
TTGATTGCCAAAACTTGCGGCGTGGCCTCATTATGAGTGCCGTGTCAATCCGACTGGTAGGGTTCACGCTGCGAAATGCTAACGGAAATCTGAACGGGGG
TGCTGTTAGTGCTTCAAGTGCTAGTATTCACATGGAAAATGTCCTCATTTTGAATGGAACTACTTTTCAAAATGGAGGAGCGGTTTATGGATATCAATCA
GATTTAACGCTCACTAACTCCAAGATTTCCAACTGCTCTGCCGCCACGAAAGGAGGCGCGATTTTCCTGGATGGTTCGAGTCTGTTTCTCAATCAGTCCA
TAATTGAACTGTCGTGGGCGAATCAAGGGGGTGGTATATACGCACAAAACACCGTCACTGTCCAGGGTAATGCAGGCAGCGAGATTTGGAATAATACTGC
TACCCTAAACGGTGGAGGAATCTGTTCATCAGGGACATTCGGTGGTACAGTGCTCAACATTTATAATAACACTGCGTCGGTTGGAGCAGGGATAGCAGCC
ATGAGTGGCAGTGTAAACTTGTCCCATGTGAACATTACCAAGAACCACGCAAATAGTGATGGTGGGGGTGTTGCGCTACTAAGCACGGCAAGTCTGGTGC
TTCAACACTCGCCAATACACAGGAATCATGCCAACCGTAATGGTGGTGGAGTTTATATGGTGTCAAATGGAACCTTTGCGAATAAAGGGGCTTCGGAAAT
CTTCAATTGCACAGCAGGTATGACGATTGATTTGCATATTGTTTGCGTAAAGGTTCCACACTAACCACAAACGTTACTTTCATCAGCCTCTGGTGGGGGA
TTCTACGGTGGTGAGTGGGCACATCCAACCGTCAATGCGATTAACGTGACTACTTCATCCGCTACATTGTCAGGAGGCTGTGCAGCTTTCTTTCACAGTT
CGGCACTTCTAACCAACGCTGTGTTTGAGCATTGCTCTGCACCTACAGGCGGAGGGCTGTATGCAGGAACCGGAAGTAACGTTTCGTTGCTGCATGGATT
TATTTTCGCTGGAACAGGAGCAAGGGGGGCTGGTATGTATGTTAATTCGAGTTCGATCGTTGGGGCAAACGACGGATCCAACTCGATCGTTCAAAGCAGC
CAAGCCGGTGCTGCTGGTGGAGGTGTATTCATCTGGGGAACACAAAGTTCAATCCAGTATTTTGACGTGTTGGATTGCTCAGCACCGAATGGAGGCGGCA
TGTTCGTACAAAACGTGTCATCCGGGGCGATGGCGTCAATGACTATCTTCGGGAATGGGGCGATTTACAATGGAGGCGGCCTCTACACACAAGCGTCATC
ATTTGAGGTTACCGATATCGCAGTGATCAATAATACTGCGGTTGTTGGGGGTGGGGTGTTTGCTATCGATTCCGGTCTTTCCGGATCCATAAGAGTAAAT
AATAATACCGGTCAGCGAGGTGGAGGTTTCGCCTCATCTGGCAATACCACGTTGGAGGGAGCAGAAATTTCTTTAAACACCGCAGTGCAAAGAGGTGGTG
GAGTCGCAGTCGAAGCCGGTGTACTGACATTGAAAAGTACCAGAATTCTATCATGCTCTTCTGGCCAGGGTGTTGGTGGAGGAATTTCCATCATGAGTGC
AGGAGTCCAACACTATTCATTGATTGTACAAAACTGTTCATCAACCCGTGGCGGAGGGATTTATGTAAATTCATCGGACTTTTTTCAGTATCCGAGCGAA
GAAAGTACCGGCATCAGTCAATATGCAGCATCGATGGCCGATAATCACGCAACTGACTATGGCGGAAGCGTCTTCATTGCCGGAGAGGGGGCACACGTCA
GCGACGTCCTAATCACTAATGGCAGCGCACCTTTTGGGGGTGGGCTCGCAGCACTCGATGCTCAAGAATGCATATCACTGAATATGGACATATCACACTC
CAACGCGACGATATCTGGCGGTGGTCTATTTTACGGGTCCGGTGTGAACTGCCTTTTACGTAGCTCTCAAGTGACAAACAATTTCGCCGGTGAATCCGGA
GGTGGCTTGGTTGTGCTAGACGCTTCATTGTTTCACTCAAACTTGGATATTTCCAACAATATTGCTCCAACTGGAGGTGGAGTACATGTTCGTAGTGATT
CGTCGGTATCAAGTCTATCGTGGTGGCAAGATCGTAACACTGAGAAATCACGTATTACCGCCAATAGTATATCTCCTGACAGTGGGGATGCAGCCAATGT
ATTGCTTAGCTGCAGCATTGAATGCGGTCTATCTGGCGCAGAGATTTCCGGTGGTATTTTATTGACTGGCAACGGTGCTGGGGTGTTCGTAAGTGGCGAC
GGTAGCGCGACCATTTCAAACAGCTCGATCACTAACAACTCGGCCGTGCAAGGTGGTGGAATCGCAGTGAGCGAAGCACAATCCACAGCACTCGAAAATG
TTTCTTTTGTCGGAAATACCGCAAGCGATCGAGGCGGTGGATTGTGGGCAGGAAAGTCAGATTTAATTTACTTTCCAGTGGTAAACATCACGGGCTGTGC
TTTCTACAATAACTCCGCAAACCTGCGCGGTGGAGGAATTTCACTGTATAAGGTGGTAGTATTTAGCACCAAGGTTCTCGTTGTCGAAAATCACGTTAAC
GACAGTAATTTCGGAAGCGGGGGCGGGCTATACGCGGATGGACAATCCGAAATCACGGCAGATACGTGGTTGATGTTGTCGAATGACGCTACTATCGGGG
GGTCCATGACTGGAGTAGCAGCTTCACAGCTAAGTTTCCTGGGGTCGACTTTTACTCGCGACGTAAATACATTTTTTACCACAAGGTGGCAAGATCTATT
TCTCAACCTTGTGGGGTTCAAATATGTGCCTGGTCTATCCGCGTACGACGTGGGAGTGCAGACAGGGGGTATCATCTATCTGTCAGACACAGAATCGGTG
CTAGAATTGCTATCATCTTTCGTGACGTCTGGGTCGGCAGATGCGGGAGGAGGGGTGTATCTGGATAACAACGCGTTTTTGTATGGCGAAAACACTGAGA
TCAGAAATAACAGTGCTACCGAGAGAGGAGGCAGTCTCTGTCTATCAAATAGTGCCCAAGCCCTCTTCGATTCTGTGAAAGTCATTTACAGTTGTGAGAA
GAGAACTGTGTCAAATTGGGTCAGTCCTTCTCTACCATAACACTAACGTTATTATTTTTTATCTACTGTAGATTGCAGCACGTTAGGGGGTGGTATTTAT
GTAGAAAACGCTGCGATATTAACTGCGAGAAGCTCCCACATATCAAACAACTTCGCTGATGACTCGGGTGGTGGCATTTATATCTCTATCGGAGACCAAA
ACTTCGTCAACTTGGCTGATTGTTACGTCGAGAGAAATATGGCGCATGGCGAAGGATGTGGTACGGCATTAGAAACCATCGGGTTTATGTTTACCCCCTA
CATATGCACAAATGCTAAAGAAGTTTGCTTGATCGTTGTTGTGCGACGAGAACAGGCGTCTATGTTGGGCGAGGCGCTGAATTGGCTGGCTTCAGAACTC
AATTCGTAGGGAACGGCGGTGTGACGTCCAGTGGGAAAAATGAGGGTGGTGGAGCAATCACTACGGTTGATGGTGACGTGGAGCTCACCAACTGTACACT
AGCAGATAATACCGCGCTAGTAGGTGGCGCAATTCACGTTGATCGCAGCGGTACTGCAGAGATTATCAACTCAGTGTTCACCGGCAATAGCGCGGATGAA
ATTGGTGGAGCGGTTGCAACAGAGCTAGAGGGGTTCTTCAATGCCACTCAGCAAACAACATTCCACAACAACCAGGCAACTCTCGGTGGAGCTGTTTCCT
CTTCAGGCTCATCCAACACCTCTCTAACATCGGTGAGTTTTGTCCAAAACAATGGTGTAAACGGTGGGGCGATGTTCATTACAGACCAAGCTACGCTTGT
GTTACATTCTGGAGATTTCAGCAGTAATACTGCTGTTTTGGGGGGCGCCATTCATTCAGACCAACAGTCCTACGTCTACATATCTGACAGCATTTTTGTC
GAAAATGCGGCCTCGTTACGCGGTGGCGCGCTGTATTATGAGTCCATCGAAAATACGAGCACAACTCGCATAACGTGTAATTCGAACGCCGCACCAAGTG
GGGGATGTATGTTTTGGATTTCGAACGCCGAGGATCTCACTCCTATCTATCCGTGCTACCGGTGCATGATGACATCCAACACAGTGTACGATATTGCCAC
GAATACGCGAGATGTCCGTCTGATGTGGTGGCCTGAAAACGTGACAAGTGGTGTTGCTGTGCTGGAGCCACCTGACGAAGAATCAATTGACGGATTAGAC
GCTCGAAATGAAAGTCTCGAGTCCACAATGTATGTGTGGCCACGCCTGAAGGCTATCGACATCTACGGACAAATTGAAGTGCTGGACAATGAAACGGAGT
GCTCCGTGAGCGATGCCCTGTACAGTGAGCACACTGAGCGTCTCAAATTTACACCTTCTAATCCGATCCGTGCTGCGATCGGAGTCCTCTCCTACCGTGA
TGCTTCTTTCACGGCGGCCAACAGAACTCTGGAAGAGGGCATTTACACTACAAACATCACGTGTACGTTGCCTTCGTCGGAAGCACGGGCTTTTGTCCAA
ACCGTGAGGTTGTTACCATGCCAACCCGGATTCTCAACCAACCAAGGGTAAGTTCAAATCGACGAGAGATCAAGAAGCGATATACATCTAACAAATGCTA
CCGTTATGATCGCTTATATTGTTGTGGCTAGAATATGTGAGCGATGCCTACAAAACACGTACAGGTAATGGCAAAAGCCTATGGAAGCAGGAGGTATGTT
GGTGAGCTAACGATACCGGGCGTTCTGCGGTGGTAATGTGCTTTAGTTTGGGAGGCGTCGGGTGCTTTGATTGCCCATCGGGAGCAAGATGTAATATGAC
AGTTCGACGGGCTACAGCGACAGTTGGAGAGGAACTTGGGACAGCTTCACCTCGCACTGAAGAGGGTTTTTACTTGTTTTCAGCCCCAGCTTCCAAGCAA
CAGGCAAGCTGTCTGAAACCATCCCAATGGAAGAAGGAAGACCCGTGTAAATCGCTTGCCCTGGCAAACCCGACGAAAAACCTATCAGATGTGATCTATG
AGTGTTCGATACTCAACAATTTTAACGTGTATTGGCCGGCGGATCGACTTTTTTCCTGTCTCTCGGGGAAGTCATTGTACACGTGCGATGTCAGTCGAAG
CTATTTGCTCCAATGAAGTCGGTCAGCACGGTTGTTTCTGATGATTATGTGTATACTTGTGCTGTCTAGGTAACGAGCGCATGTCAAGCTGATGTTTCGT
TGCAGACACTTGCACTATCATCTTCCGTGAATAATGTATCGTGTGCCAATGGGTACGGCCTTGCTATTTGCTCGGTGTGCGCCGATGGATACAAGCGGGC
TCAGGATAATTCATGTCTGCGTAAGTACACTTGTGCTCGTCATCTATCAGTTGAGTCAGTTACTTACATGAATTTGGTGATGCAGCGTGCGCGAAGGCGA
ACGCCAAGGTTCGGTCTTCGATTCAATGGCAGAACTTTGTCATGCCTGTGATGATTGTTATTGGGGTAGCTGGTGGACTCTATGGTATGCGCGTTTATCT
AGGCGATCGCACGGAAATTGGTCTGCTCGCAAAGGCTGAAGCTGACAGACGATTCAAACCTCACCGTCCAAAGAACCGAAGACAACCGAAGGCTAAGGTG
GCGATAGCGGATCGAGTCAATGCAAAAATCACGGGTTTCCTGCAGAAGATCCAAAAGCGGAACTCAAAGGTGCTCTTCGGAGTAGAAGTCAACCCTCCGG
CGCCAATGTTCCCGGTTAGTCCAAGCAAATTCAAGATCTTGATCGGATTCTTCCAAATCTTTGGCAACTTTCAAAGTTCATTCGTGGTGAAGTGGTCGGC
AAACATACAAAACTTCATGAGTTTCTCGCAAAAATTCAATCTGGTACGTTGTCTGTAAATTTCATCAAATCTCTGTACAGGACTGATGCGTCCTTCCGAG
TGAGTAGGATCTGGTGGCGATTGCCAACATCGATTGCGTGGTCGCGAAAACCTTTTACTTCAATTTCATGTACGTTTCTAAATGTTTCGAAGCCGCCAAG
TATGATATAACGTTCTCGTAAATTCTACTGGTGTAGGGTGACTGTGAGTCAGGTTGTTGCCGTCCTCACTGTGATAACCGCCTACTTCTACGCAGGTATG
CGCAGCTACCGTGCGAAGCTGCATTTAATCCCCCGAAATTGTTTGCGTTGTGGCCTCCCGGTGTTTGAGAGTGAGATCGTTCATAACGACGACGAAAGCT
TCAACCCTCTCCTACTGCTTCGGAGCTGGTGGCGCACGCACAACTTTTACAAGCGCGCTGTATCAGCCACCGCTGGAGAAGACGACGCAAAGGAGAATGA
TAATTCTGCTGCTTTCTCGGTCATCAAGGAGACGCGCTTACTCAAGCGAAAGTTTGGGATGTCCCAGGTGCGCACCCCGTACCTGGGTTTGTTCCGGTCG
GTGCATTCTAAGTGCCCTGTAAAGGGTCATGTGCTTTCTGGTGTCATGCTTGAGCGCACCATCCGCAGCAATCTTCGGGTGTGGCAAGCTCGGGTGAAAC
TTCGCATGAATTACCTTACGTACCGCAACAAATGTCTGAAACTCTACTGCTGGATCGCGTTGTTCCTGTACCCGTCCGTCTCGAAGTCGATATTGGCGAT
CTACAACTGCCAGCAAGTTGGTGAGACTTACTATCTCGTGGCTGATCGTCGCCTGGTGTGCTACAATGGGCAGTGGGCAGTGTTTGGTATCATCGCAACC
GTGGGTGTCGTCGTGTGGGTTGTAGGCATTCCGTTCTTCTTTGGCTTACTTATCTGGCTGGCTCAGGATCGTGCTATTGCTGCACGCCTGAAGGTACTGA
ACAAACTACCGCAAATGCGCGTGCAACGCGAGAAGTGGCTCAAAGCGGTAGAACAGCAGCAAATAGCAGACAATCGGTTTGTTCGAAATATGGAGGACAC
GGAGGTCCAGAACGAGGAGCTGGCGAAGTACATGAAGCGCAAGAATTTGACGGTAACGTAGCATTAAGCCACTGGTGGAGGTTGTGCCGCAGCAAAGACT
CACTGAATGACAATTTTTGTACCAGGACTCTACAGTGCAAGCGCGCCTGGGATTTATCTACGCAGAATGTAAGTTGTGATTTTTGAGTTATGCTTCTTGG
CCACTTAGTGTTTACGGAGTCGCACGCAACACCTTTTGCTGCTGCAGATTCGATCGAGTACTGGTGGTTCGAAGTCGTGGATCTCTCAAGAAAGCTTTTC
CTAAGTGGCGTGATCATATTCGTGGAGAATGGAAGCGTGGAGCAAGTGCTACTGGCGATTGCTGTCTGGTACGTTTATCCTTACGCCTTGTGATAGCGGT
TGCATCTCACTGTACTAATTCTCATGAGCGCCTCGCAGCCTGGTGACGATGTGGTTTCTACTGTATTTCCAGCCGTACGAAGGCTACTCCGACAACCTCA
TGGCCAGTGTGTCACAGCTGCAGCTCTTCTTCACCTTGTGGCTTGGCGTCATGATCAACCTCAACAACCTCAACGTCGAGTCGCAGATCAACGTGGACCT
GCTGAGCGTCGTCCTGATCGGCACGTGCGTCGCCGTCACGATGTTCGGCTTGGTGCTGATTGTCGGGGAAGGCCTCACCGAGTCCCGGCGAATGCGAATC
GAGACTGTGGCCGCGCGCAAGGAGCAACTGCAACAGGAGGTTCGGAAGCGGTGGGTGATGGCGTTCAACTACGCCGCGTTCGAGGCTCAGCTGCTGCGTC
GCGGTGGCCAGTTCAGCTTCACCGACCTGAGCGCGCCTGCTATGCTGGAGGCAGCCCGC